ORK02125

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK02125

Order Kazusa clone(s) from :

Accession No	AB209257
Product ID	ORK02125
Clone name	fk00170
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	SUPT5H
cDNA sequence	DNA sequence (3618 bp) Predicted protein sequence (1116 aa)
HaloTag ORF Clone	FHC02125
Flexi ORF Clone	FXC02125
Description	Transcription elongation factor SPT5 (hSPT5) (DRB sensitivity-inducing factor large subunit) (DSIF large subunit) (DSIF p160) (Tat- cotransactivator 1 protein) (Tat-CT1 protein).

Features of the cloned cDNA sequence

Description

Length: 3618 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	267 bp
Genome contig ID	gi42406306f_44528282
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- GTACCGTCTTTCAATAAAAAGAAGCTGTTTGGTCT
Flanking genome sequence (130866 - 130915)	----+--------+--------+--------+--------+----* AAAAGTGCGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGT

Features of the protein sequence

Description

Length: 1116 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92494	100.0	suppressor of T...	Homo sapiens
XP_512652	98.7	suppressor of T...	Pan troglodytes
XP_001088710	99.8	similar to supp...	Macaca mulatta
O00267	99.6	Transcription e...	Homo sapiens
Q5R405	99.5	Transcription e...	Pongo abelii

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR003257	208	337	PD005267	Transcription antitermination protein
HMMPfam	IPR005100	168	217	PF03439	Supt5 repeat
	IPR005100	253	301	PF03439	Supt5 repeat
	IPR005824	501	532	PF00467	KOW
	IPR005824	733	766	PF00467	KOW
HMMSmart	IPR006645	205	296	SM00738	Transcription antitermination protein
	IPR005824	301	328	SM00739	KOW
	IPR005824	448	475	SM00739	KOW
	IPR005824	500	527	SM00739	KOW
	IPR005824	622	649	SM00739	KOW
	IPR005824	732	759	SM00739	KOW
	IPR005824	1063	1090	SM00739	KOW

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp