ORK02132

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK02132

Order Kazusa clone(s) from :

Accession No	AB209387
Product ID	ORK02132
Clone name	fh20087
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	ZNF589
cDNA sequence	DNA sequence (5612 bp) Predicted protein sequence (379 aa)
HaloTag ORF Clone	FHC02132
Flexi ORF Clone	FXC02132
Description	zinc finger protein 589

Features of the cloned cDNA sequence

Description

Length: 5612 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	4470 bp
Genome contig ID	gi89161205f_48157619
PolyA signal sequence (ATTAAA,-33)	+--------+--------+----*----+---- AAATTAAACTTTTGCCTGAGTGCTGGTTTTACTTC
Flanking genome sequence (132133 - 132182)	----+--------+--------+--------+--------+----* ATGGCACCGAGCATTTCATCCTAGAGCATTTTATATCCAACAATTCTGGG

Features of the protein sequence

Description

Length: 379 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92624	2.6e-158	100.0	ZNF589 protein ...	Homo sapiens
AAH48798	3.4e-158	100.0	ZNF589 protein ...	Homo sapiens
AAH05859	7e-156	100.0	ZNF589 protein ...	Homo sapiens
AAH06247	3.5e-154	99.1	ZNF589 protein ...	Homo sapiens
Q86UQ0	1.7e-152	100.0	Zinc finger pro...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR007087	265	286	PD000003	Zinc finger
	IPR007087	319	342	PD000003	Zinc finger
	IPR007087	347	370	PD000003	Zinc finger
HMMPfam	IPR001909	50	90	PF01352	KRAB box
	IPR007087	263	285	PF00096	Zinc finger
	IPR007087	291	313	PF00096	Zinc finger
	IPR007087	319	341	PF00096	Zinc finger
	IPR007087	347	369	PF00096	Zinc finger
HMMSmart	IPR001909	50	103	SM00349	KRAB box
	IPR015880	97	120	SM00355	Zinc finger
	IPR015880	263	285	SM00355	Zinc finger
	IPR015880	291	313	SM00355	Zinc finger
	IPR015880	319	341	SM00355	Zinc finger
	IPR015880	347	369	SM00355	Zinc finger
ProfileScan	IPR001909	50	123	PS50805	KRAB box
	IPR007087	263	290	PS50157	Zinc finger
	IPR007087	291	318	PS50157	Zinc finger
	IPR007087	319	346	PS50157	Zinc finger
	IPR007087	347	374	PS50157	Zinc finger
ScanRegExp	IPR007087	265	285	PS00028	Zinc finger
	IPR007087	293	313	PS00028	Zinc finger
	IPR007087	321	341	PS00028	Zinc finger
	IPR007087	349	369	PS00028	Zinc finger

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp