Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK02134
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK02134
Clone name pg00425
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol SORL1
cDNA sequence DNA sequence (6761 bp)
Predicted protein sequence (2212 aa)
Flexi ORF Clone FXC02134
Description Sortilin-related receptor precursor (Sorting protein-related receptor containing LDLR class A repeats) (SorLA) (SorLA-1) (Low-density lipoprotein receptor relative with 11 ligand-binding repeats) (LDLR relative with 11 ligand-binding repeats) (LR11).
Features of the cloned cDNA sequence

Length: 6761 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 121 bp
Genome contig ID gi51511727f_120728256
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
AGTTGCAATATGTTATTTTTATATGGGCCAAAAAC
Flanking genome sequence
(277349 - 277398)
----+----*----+----*----+----*----+----*----+----*
AAAAAACAAAAAAAAAAAAAAGGAAAGAAAGGAATGAATAAACTTTGTAG

Features of the protein sequence

Length: 2212 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q92673 0 100.0 Sortilin-relate...
Homo sapiens
Q95209 0 94.2 Sortilin-relate...
Oryctolagus cun...
O88307 0 93.3 Sortilin-relate...
Mus musculus
BAE27834 0 93.2 unnamed protein...
Mus musculus
BAA31219 0 93.2 LR11 [Mus muscu...
Mus musculus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan IPR002172 1166 1187 PR00261 Low density lipoprotein-receptor
IPR002172 1207 1228 PR00261 Low density lipoprotein-receptor
IPR002172 1245 1266 PR00261 Low density lipoprotein-receptor
IPR002172 1285 1306 PR00261 Low density lipoprotein-receptor
IPR002172 1333 1354 PR00261 Low density lipoprotein-receptor
IPR002172 1377 1398 PR00261 Low density lipoprotein-receptor
HMMPfam IPR002860 134 145 PF02012 Glycoside hydrolase
IPR002860 230 241 PF02012 Glycoside hydrolase
IPR002860 439 450 PF02012 Glycoside hydrolase
IPR002860 519 530 PF02012 Glycoside hydrolase
IPR002860 560 571 PF02012 Glycoside hydrolase
IPR000033 798 840 PF00058 Low-density lipoprotein receptor
IPR000033 842 884 PF00058 Low-density lipoprotein receptor
IPR000033 886 929 PF00058 Low-density lipoprotein receptor
IPR000033 931 969 PF00058 Low-density lipoprotein receptor
IPR002172 1074 1110 PF00057 Low density lipoprotein-receptor
IPR002172 1113 1151 PF00057 Low density lipoprotein-receptor
IPR002172 1154 1190 PF00057 Low density lipoprotein-receptor
IPR002172 1195 1233 PF00057 Low density lipoprotein-receptor
IPR002172 1235 1269 PF00057 Low density lipoprotein-receptor
IPR002172 1321 1357 PF00057 Low density lipoprotein-receptor
IPR002172 1364 1401 PF00057 Low density lipoprotein-receptor
IPR002172 1415 1451 PF00057 Low density lipoprotein-receptor
IPR002172 1467 1504 PF00057 Low density lipoprotein-receptor
IPR002172 1510 1547 PF00057 Low density lipoprotein-receptor
IPR003961 1553 1626 PF00041 Fibronectin
IPR003961 1649 1733 PF00041 Fibronectin
IPR003961 1929 2010 PF00041 Fibronectin
HMMSmart IPR006581 122 755 SM00602 VPS10
IPR000033 778 820 SM00135 Low-density lipoprotein receptor
IPR000033 822 864 SM00135 Low-density lipoprotein receptor
IPR000033 865 910 SM00135 Low-density lipoprotein receptor
IPR000033 911 951 SM00135 Low-density lipoprotein receptor
IPR000033 952 992 SM00135 Low-density lipoprotein receptor
IPR002172 1075 1112 SM00192 Low density lipoprotein-receptor
IPR002172 1114 1153 SM00192 Low density lipoprotein-receptor
IPR002172 1155 1192 SM00192 Low density lipoprotein-receptor
IPR002172 1196 1235 SM00192 Low density lipoprotein-receptor
IPR002172 1236 1271 SM00192 Low density lipoprotein-receptor
IPR002172 1272 1315 SM00192 Low density lipoprotein-receptor
IPR002172 1322 1359 SM00192 Low density lipoprotein-receptor
IPR002172 1365 1403 SM00192 Low density lipoprotein-receptor
IPR002172 1416 1453 SM00192 Low density lipoprotein-receptor
IPR002172 1468 1506 SM00192 Low density lipoprotein-receptor
IPR002172 1511 1549 SM00192 Low density lipoprotein-receptor
IPR003961 1553 1636 SM00060 Fibronectin
IPR003961 1649 1730 SM00060 Fibronectin
IPR003961 1745 1827 SM00060 Fibronectin
IPR003961 1841 1917 SM00060 Fibronectin
IPR003961 1930 2013 SM00060 Fibronectin
IPR003961 2022 2104 SM00060 Fibronectin
ProfileScan IPR000033 798 841 PS51120 Low-density lipoprotein receptor
IPR000033 842 885 PS51120 Low-density lipoprotein receptor
IPR000033 886 927 PS51120 Low-density lipoprotein receptor
IPR000033 929 970 PS51120 Low-density lipoprotein receptor
IPR000033 971 1011 PS51120 Low-density lipoprotein receptor
IPR002172 1075 1111 PS50068 Low density lipoprotein-receptor
IPR002172 1114 1152 PS50068 Low density lipoprotein-receptor
IPR002172 1155 1191 PS50068 Low density lipoprotein-receptor
IPR002172 1196 1234 PS50068 Low density lipoprotein-receptor
IPR002172 1232 1270 PS50068 Low density lipoprotein-receptor
IPR002172 1272 1314 PS50068 Low density lipoprotein-receptor
IPR002172 1322 1358 PS50068 Low density lipoprotein-receptor
IPR002172 1365 1402 PS50068 Low density lipoprotein-receptor
IPR002172 1416 1452 PS50068 Low density lipoprotein-receptor
IPR002172 1468 1505 PS50068 Low density lipoprotein-receptor
IPR002172 1511 1548 PS50068 Low density lipoprotein-receptor
IPR003961 1552 1644 PS50853 Fibronectin
IPR003961 1649 1740 PS50853 Fibronectin
IPR003961 1747 1836 PS50853 Fibronectin
IPR003961 1841 1925 PS50853 Fibronectin
IPR003961 1932 2021 PS50853 Fibronectin
IPR003961 2022 2116 PS50853 Fibronectin
ScanRegExp IPR013032 1056 1069 PS01186 EGF-like region
IPR002172 1088 1110 PS01209 Low density lipoprotein-receptor
IPR002172 1129 1151 PS01209 Low density lipoprotein-receptor
IPR002172 1168 1190 PS01209 Low density lipoprotein-receptor
IPR000923 1199 1212 PS00196 Blue (type 1) copper domain
IPR002172 1209 1233 PS01209 Low density lipoprotein-receptor
IPR002172 1247 1269 PS01209 Low density lipoprotein-receptor
IPR002172 1287 1313 PS01209 Low density lipoprotein-receptor
IPR002172 1335 1357 PS01209 Low density lipoprotein-receptor
IPR002172 1379 1401 PS01209 Low density lipoprotein-receptor
IPR002172 1429 1451 PS01209 Low density lipoprotein-receptor
IPR002172 1525 1547 PS01209 Low density lipoprotein-receptor

Prediction of transmembrane (TM) segments
Method No. N terminal transmembrane region C terminal type length
SOSUI2 1 9 RLPFLFTLVALLPPGALCEVWTQ 31 SECONDARY 23
2 2134 VAAVVVPILFLILLSLGVGFAIL 2156 PRIMARY 23
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp