ORK02147

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK02147

Order Kazusa clone(s) from :

Accession No
Product ID	ORK02147
Clone name	fk13033
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	GNG10
cDNA sequence	DNA sequence (3355 bp) Predicted protein sequence (70 aa)
HaloTag ORF Clone	FHC02147
Flexi ORF Clone	FXC02147
Description	Guanine nucleotide-binding protein G(I)/G(S)/G(O) gamma-10 subunit precursor.

Features of the cloned cDNA sequence

Description

Length: 3355 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	3141 bp
Genome contig ID	gi89161216f_113363729
PolyA signal sequence (ATTAAA,-31)	+--------+--------+----*----+---- AATGATTAAAAACTAACATGAAAATATTACAACCT
Flanking genome sequence (108460 - 108509)	----+--------+--------+--------+--------+----* AAAAGAATTCTTAACTTCACAAGTGTTTTACTTCGACGATGTGCCTTTGA

Features of the protein sequence

Description

Length: 70 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
P50151	5e-26	100.0	Guanine nucleot...	Homo sapiens
AAI03020	1.2e-25	98.5	GNG10 protein [...	Bos taurus
EAW68577	3e-25	98.5	hCG1992840, iso...	Homo sapiens
Q9CXP8	6.1e-25	95.5	Guanine nucleot...	Mus musculus
XP_001088802	4.3e-24	94.1	similar to Guan...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001770	12	63	PD003783	G-protein
FPrintScan	IPR001770	12	27	PR00321	G-protein
	IPR001770	28	42	PR00321	G-protein
	IPR001770	48	65	PR00321	G-protein
HMMPfam	IPR015898	9	63	PF00631	G-protein
HMMSmart	IPR015898	9	70	SM00224	G-protein
ProfileScan	IPR001770	5	70	PS50058	G-protein

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp