Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK02150
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK02150
Clone name fk13968
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol SF3B2
cDNA sequence DNA sequence (3580 bp)
Predicted protein sequence (954 aa)
Flexi ORF Clone FXC02150
Description Splicing factor 3B subunit 2 (Spliceosome-associated protein 145) (SAP 145) (SF3b150) (Pre-mRNA-splicing factor SF3b 145 kDa subunit).
Features of the cloned cDNA sequence

Length: 3580 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 144 bp
Genome contig ID gi51511727f_65475684
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
TAGACCTGTTTTGTAAATAAAGCTGTTTCCCAAGG
Flanking genome sequence
(117254 - 117303)
----+----*----+----*----+----*----+----*----+----*
AAAGAGATGAATATTTAACACTCCTGAGCCTCCCTCATCTCCTTTTAGCC

Features of the protein sequence

Length: 954 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
EAW74492 0 100.0 splicing factor...
Homo sapiens
AAH00401 0 100.0 SF3B2 protein [...
Homo sapiens
BAF83539 0 99.7 unnamed protein...
Homo sapiens
XP_533224 0 98.1 similar to Spli...
Canis lupus fam...
AAH53577 0 99.8 SF3B2 protein [...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR003034 83 117 PF02037 DNA-binding SAP
IPR007180 528 656 PF04037 Protein of unknown function DUF382
IPR006568 664 716 PF04046 PSP
HMMSmart IPR003034 83 117 SM00513 DNA-binding SAP
IPR006568 660 718 SM00581 PSP
ProfileScan IPR003034 83 117 PS50800 DNA-binding SAP
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp