ORK02163

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK02163

Order Kazusa clone(s) from :

Accession No
Product ID	ORK02163
Clone name	bf00778
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	EED
cDNA sequence	DNA sequence (2371 bp) Predicted protein sequence (528 aa)
HaloTag ORF Clone	FHC02163
Flexi ORF Clone	FXC02163
Description	embryonic ectoderm development isoform b

Features of the cloned cDNA sequence

Description

Length: 2371 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	741 bp
Genome contig ID	gi51511727f_85533493
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- AGACTCTACTGCTTTTAATAAAAATTTATTTTTGT
Flanking genome sequence (133935 - 133984)	----+--------+--------+--------+--------+----* AAAGCTGTGTGTTTAGTTACTTTCATTGTGGTGAAAAAAAGTTAAAAGTA

Features of the protein sequence

Description

Length: 528 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAC53302	1.3e-173	95.7	embryonic ectod...	Mus musculus
AAC23685	5.2e-173	98.1	embryonic ectod...	Homo sapiens
EAW75131	3.6e-147	100.0	embryonic ectod...	Homo sapiens
BAF84809	3.9e-147	100.0	unnamed protein...	Homo sapiens
AAB38319	3.9e-147	100.0	embryonic ectod...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001680	316	348	PD000018	WD40 repeat
FPrintScan	IPR001680	334	348	PR00320	WD40 repeat
	IPR001680	379	393	PR00320	WD40 repeat
	IPR001680	505	519	PR00320	WD40 repeat
HMMPfam	IPR001680	308	347	PF00400	WD40 repeat
HMMPfam	IPR001680	362	392	PF00400	WD40 repeat
HMMSmart	IPR001680	209	253	SM00320	WD40 repeat
	IPR001680	259	304	SM00320	WD40 repeat
	IPR001680	307	347	SM00320	WD40 repeat
	IPR001680	350	392	SM00320	WD40 repeat
	IPR001680	423	460	SM00320	WD40 repeat
ProfileScan	IPR001680	314	356	PS50082	WD40 repeat
	IPR001680	314	401	PS50294	WD40 repeat
	IPR001680	360	401	PS50082	WD40 repeat
ScanRegExp	IPR001680	334	348	PS00678	WD40 repeat

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp