Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK02164
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK02164
Clone name bm00941
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol PLTP
cDNA sequence DNA sequence (1603 bp)
Predicted protein sequence (506 aa)
Flexi ORF Clone FXC02164
Description Phospholipid transfer protein precursor (Lipid transfer protein II).
Features of the cloned cDNA sequence

Length: 1603 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 47 bp
Genome contig ID gi51511747r_43860940
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
CAAGCTGGCAGCTGTCATTCAGGACCCCAACCCCT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
CTCAGCCCCTCTTTTCCCACATTCATAGCCTGTAGTGCCCCCTCTAACCC

Features of the protein sequence

Length: 506 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
EAW75784 8.4e-212 99.4 phospholipid tr...
Homo sapiens
P55058 1.1e-208 100.0 Phospholipid tr...
Homo sapiens
BAD96410 2.9e-208 99.7 phospholipid tr...
Homo sapiens
AAH19847 4.7e-208 99.7 Phospholipid tr...
Homo sapiens
XP_001158807 7.2e-206 98.7 phospholipid tr...
Pan troglodytes
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR001124 43 212 PF01273 Lipid-binding serum glycoprotein
IPR001124 241 477 PF02886 Lipid-binding serum glycoprotein
HMMSmart IPR001124 38 256 SM00328 Lipid-binding serum glycoprotein
IPR001124 271 473 SM00329 Lipid-binding serum glycoprotein
ScanRegExp IPR001124 33 65 PS00400 Lipid-binding serum glycoprotein
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp