Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK02167
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK02167
Clone name bm00771
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol LMO2
cDNA sequence DNA sequence (1243 bp)
Predicted protein sequence (168 aa)
Flexi ORF Clone FXC02167
Description Rhombotin-2 (LIM domain only protein 2) (Cysteine-rich protein TTG-2) (T-cell translocation protein 2).
Features of the cloned cDNA sequence

Length: 1243 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 735 bp
Genome contig ID gi51511727r_33736743
PolyA signal sequence
(None)		 
+----*----+----*----+----*----+----
ATCCTAGATTATATCAAAGTATTTGTCGTGTGTAG
Flanking genome sequence
(100000 - 99951)		 
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAACAGCTCTGCAGGCTTAATAAAAATGACAGACTGAAATACAG

Features of the protein sequence

Length: 168 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
XP_001145456 8.4e-71 100.0 hypothetical pr...
 Pan troglodytes
EAW68182 8.4e-71 100.0 LIM domain only...
 Homo sapiens
XP_001145763 9.1e-71 100.0 hypothetical pr...
 Pan troglodytes
CAM18988 1.7e-70 99.4 LIM domain only...
 Mus musculus
CAM18986 1.8e-70 99.4 LIM domain only...
 Mus musculus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR001781 40 97 PD000094 Zinc finger
IPR001781 104 160 PD000094 Zinc finger
HMMPfam IPR001781 40 99 PF00412 Zinc finger
IPR001781 104 163 PF00412 Zinc finger
HMMSmart IPR001781 39 93 SM00132 Zinc finger
IPR001781 103 157 SM00132 Zinc finger
ProfileScan IPR001781 38 100 PS50023 Zinc finger
IPR001781 102 164 PS50023 Zinc finger
ScanRegExp IPR001781 40 74 PS00478 Zinc finger
IPR001781 104 139 PS00478 Zinc finger
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp