ORK02172

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK02172

Order Kazusa clone(s) from :

Accession No
Product ID	ORK02172
Clone name	bm02190
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	KIF3A
cDNA sequence	DNA sequence (2573 bp) Predicted protein sequence (730 aa)
HaloTag ORF Clone	FHC02172
Flexi ORF Clone	FXC02172
Description	kinesin family member 3A

Features of the cloned cDNA sequence

Description

Length: 2573 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	357 bp
Genome contig ID	gi51511721r_131959868
PolyA signal sequence (None)	+--------+--------+----*----+---- TACTGTATATTTAGGTAACTAGAATTTCAAAATAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAAAAACTGTGTCCTGTTTTGCACATAGAAAGAAGCAGATCAGAT

Features of the protein sequence

Description

Length: 730 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD93017	4e-216	100.0	Kinesin-like pr...	Homo sapiens
BAG72603	2.9e-207	100.0	kinesin family ...	synthetic construct
Q4R628	3.3e-207	99.8	Kinesin-like pr...	Macaca fascicularis
Q5R4H3	9.8e-207	99.7	Kinesin-like pr...	Pongo abelii
Q9Y496	2.1e-206	99.7	Kinesin-like pr...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001752	119	140	PR00380	Kinesin
	IPR001752	239	256	PR00380	Kinesin
	IPR001752	273	291	PR00380	Kinesin
	IPR001752	323	344	PR00380	Kinesin
HMMPfam	IPR001752	48	374	PF00225	Kinesin
HMMSmart	IPR001752	40	381	SM00129	Kinesin
ProfileScan	IPR001752	39	303	PS50067	Kinesin
ScanRegExp	IPR001752	272	283	PS00411	Kinesin

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp