Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK02177
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK02177
Clone name bm02949
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol POLD2
cDNA sequence DNA sequence (1759 bp)
Predicted protein sequence (510 aa)
Flexi ORF Clone FXC02177
Description DNA polymerase subunit delta 2 (EC 2.7.7.7) (DNA polymerase subunit delta p50).
Features of the cloned cDNA sequence

Length: 1759 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 97 bp
Genome contig ID gi89161213r_44020812
PolyA signal sequence
(AATAAA,-27)
+----*----+----*----+----*----+----
GCATTGTAAATAAAGCCTGAGCACTTGCTGATGCG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AGCCTTGAGCCCTGGGCACTCTGGCTATGGGACTCCTGCAGGGGTGCCCA

Features of the protein sequence

Length: 510 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
P49005 1.2e-202 100.0 DNA polymerase ...
Homo sapiens
BAG35221 2.6e-202 99.7 unnamed protein...
Homo sapiens
BAE01484 1.7e-200 98.9 unnamed protein...
Macaca fascicularis
XP_001915605 2.6e-193 95.3 similar to Poly...
Equus caballus
P49004 7.8e-193 95.5 DNA polymerase ...
Bos taurus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR007185 237 453 PF04042 DNA polymerase epsilon subunit B
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp