ORK02181

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK02181

Order Kazusa clone(s) from :

Accession No
Product ID	ORK02181
Clone name	bm03376
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	MPP1
cDNA sequence	DNA sequence (1929 bp) Predicted protein sequence (478 aa)
HaloTag ORF Clone	FHC02181
Flexi ORF Clone	FXC02181
Description	55 kDa erythrocyte membrane protein (p55) (Membrane protein, palmitoylated 1).

Features of the cloned cDNA sequence

Description

Length: 1929 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	491 bp
Genome contig ID	gi89161218r_153560155
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- CTTCAAAAGCAATAAAAATGCTGTGTTGAAATGCC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AATGACCTTGTAACTCTGGGTTTCCACACAAAAAGAAATGTGGCCCATTT

Features of the protein sequence

Description

Length: 478 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q00013	2.5e-187	100.0	55 kDa erythroc...	Homo sapiens
AAQ02494	2.5e-187	100.0	membrane protei...	synthetic construct
XP_001143670	5.2e-187	99.7	palmitoylated m...	Pan troglodytes
BAD97116	9.4e-187	99.7	palmitoylated m...	Homo sapiens
CAH90043	1.3e-186	99.5	hypothetical pr...	Pongo abelii

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001452	173	232	PD000066	Src homology-3
FPrintScan	IPR001452	173	183	PR00452	Src homology-3
	IPR001452	194	209	PR00452	Src homology-3
	IPR001452	211	220	PR00452	Src homology-3
HMMPfam	IPR001478	83	161	PF00595	PDZ/DHR/GLGF
	IPR011511	174	238	PF07653	Variant SH3
	IPR008144	330	434	PF00625	Guanylate kinase
HMMSmart	IPR001478	92	164	SM00228	PDZ/DHR/GLGF
	IPR001452	173	239	SM00326	Src homology-3
	IPR008145	293	466	SM00072	Guanylate kinase/L-type calcium channel region
ProfileScan	IPR001478	83	164	PS50106	PDZ/DHR/GLGF
	IPR001452	170	240	PS50002	Src homology-3
	IPR008144	294	463	PS50052	Guanylate kinase
ScanRegExp	IPR008144	329	346	PS00856	Guanylate kinase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp