Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK02183
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK02183
Clone name bm03494
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol SMAD1
cDNA sequence DNA sequence (1722 bp)
Predicted protein sequence (453 aa)
Flexi ORF Clone FXC02183
Description Mothers against decapentaplegic homolog 1 (SMAD 1) (Mothers against DPP homolog 1) (Mad-related protein 1) (Transforming growth factor- beta-signaling protein 1) (BSP-1) (hSMAD1) (JV4-1).
Features of the cloned cDNA sequence

Length: 1722 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 145 bp
Genome contig ID gi89161207f_146522521
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
CTCTGTGACCAACTGTTGGATTCAGAAATTTAAAC
Flanking genome sequence
(176162 - 176211)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAACACACACACCTTGGTAACATACTGTTGATATCAAG

Features of the protein sequence

Length: 453 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
XP_001147962 1.3e-169 100.0 Sma- and Mad-re...
Pan troglodytes
XP_867335 6e-169 99.5 similar to MAD ...
Canis lupus fam...
XP_867292 5.3e-168 98.8 similar to Moth...
Canis lupus fam...
XP_867274 6.8e-160 94.2 similar to Moth...
Canis lupus fam...
XP_001363672 8e-156 93.1 similar to late...
Monodelphis dom...
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR003619 54 158 PF03165 MAD homology 1
IPR001132 253 431 PF03166 MAD homology 2
HMMSmart IPR003619 52 161 SM00523 MAD homology 1
IPR001132 257 429 SM00524 MAD homology 2
ProfileScan IPR013019 39 163 PS51075 MAD homology
IPR001132 259 453 PS51076 MAD homology 2
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp