Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK02190
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK02190
Clone name bm04548
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol SNAP25
cDNA sequence DNA sequence (1958 bp)
Predicted protein sequence (219 aa)
Flexi ORF Clone FXC02190
Description Synaptosomal-associated protein 25 (SNAP-25) (Synaptosomal-associated 25 kDa protein) (Super protein) (SUP).
Features of the cloned cDNA sequence

Length: 1958 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 1137 bp
Genome contig ID gi51511747f_10047489
PolyA signal sequence
(GATAAA,-28)		 
+----*----+----*----+----*----+----
ACTGTGAGATAAATATCATTATAGCATGTAATATT
Flanking genome sequence
(188495 - 188544)		 
----+----*----+----*----+----*----+----*----+----*
AAATTCCTCCTGTCTCCTCTGTCAGTTTGTGAAGTGATTGACATTTTGTA

Features of the protein sequence

Length: 219 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
P60881 3.6e-74 100.0 Synaptosomal-as...
 Rattus norvegicus
BAD97337 4.2e-74 99.5 synaptosomal-as...
 Homo sapiens
Q5NVG5 1.1e-73 99.5 Synaptosomal-as...
 Pongo abelii
BAE01879 1.3e-73 99.5 unnamed protein...
 Macaca fascicularis
CAH92513 2.6e-73 99.0 hypothetical pr...
 Pongo abelii
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000928 104 154 PF00835 SNAP-25
IPR000727 158 217 PF05739 Target SNARE coiled-coil region
HMMSmart IPR000727 27 94 SM00397 Target SNARE coiled-coil region
IPR000727 148 215 SM00397 Target SNARE coiled-coil region
ProfileScan IPR000727 32 94 PS50192 Target SNARE coiled-coil region
IPR000727 153 215 PS50192 Target SNARE coiled-coil region
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp