ORK02192

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK02192

Order Kazusa clone(s) from :

Accession No
Product ID	ORK02192
Clone name	bm04773
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	PRKAG1
cDNA sequence	DNA sequence (1681 bp) Predicted protein sequence (351 aa)
HaloTag ORF Clone	FHC02192
Flexi ORF Clone	FXC02192
Description	5'-AMP-activated protein kinase subunit gamma-1 (AMPK gamma-1 chain) (AMPKg).

Features of the cloned cDNA sequence

Description

Length: 1681 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	624 bp
Genome contig ID	gi89161190r_47582325
PolyA signal sequence (ATTAAA,-25)	+--------+--------+----*----+---- GGCAAATCTAATTAAATGACAGGAATCTCTTCACG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATATTGCAGTGTTTGATTTTTACAGTTGATGGGTACTACCTTCCTACTTT

Features of the protein sequence

Description

Length: 351 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
P54619	1.3e-134	100.0	5'-AMP-activate...	Homo sapiens
XP_001105687	2.5e-134	99.6	AMP-activated p...	Macaca mulatta
XP_509039	8.3e-133	99.3	similar to 5-AM...	Pan troglodytes
Q09138	4.3e-132	99.0	5'-AMP-activate...	Sus scrofa
XP_543685	4.3e-132	99.0	similar to 5-AM...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000644	62	197	PF00571	Cystathionine beta-synthase
HMMPfam	IPR000644	218	343	PF00571	Cystathionine beta-synthase
HMMSmart	IPR000644	67	116	SM00116	Cystathionine beta-synthase
	IPR000644	148	197	SM00116	Cystathionine beta-synthase
	IPR000644	223	271	SM00116	Cystathionine beta-synthase
	IPR000644	295	343	SM00116	Cystathionine beta-synthase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp