Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK02195
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK02195
Clone name bm05540
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol PGD
cDNA sequence DNA sequence (1885 bp)
Predicted protein sequence (496 aa)
Flexi ORF Clone FXC02195
Description 6-phosphogluconate dehydrogenase, decarboxylating (EC 1.1.1.44).
Features of the cloned cDNA sequence

Length: 1885 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 394 bp
Genome contig ID gi89161185f_10281723
PolyA signal sequence
(AATAAA,-21)		 
+----*----+----*----+----*----+----
TTTTTCCTTTACTCAATAAAAGCTACATCAGACTG
Flanking genome sequence
(121066 - 121115)		 
----+----*----+----*----+----*----+----*----+----*
ATGCTCTTTCTCCAGATTCTTAGTCTCACCTCGGCCACATGGAGCCATTA

Features of the protein sequence

Length: 496 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
P52209 7.5e-206 100.0 6-phosphoglucon...
 Homo sapiens
AAP88742 7.5e-206 100.0 phosphogluconat...
 synthetic construct
AAA75302 4e-205 99.5 phosphogluconat...
 Homo sapiens
BAE88189 1.9e-200 99.5 unnamed protein...
 Macaca fascicularis
XP_001915128 3.6e-197 95.6 similar to 6-ph...
 Equus caballus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan IPR006183 17 40 PR00076 6-phosphogluconate dehydrogenase
IPR006183 80 109 PR00076 6-phosphogluconate dehydrogenase
IPR006183 133 158 PR00076 6-phosphogluconate dehydrogenase
IPR006183 182 210 PR00076 6-phosphogluconate dehydrogenase
IPR006183 263 290 PR00076 6-phosphogluconate dehydrogenase
IPR006183 371 393 PR00076 6-phosphogluconate dehydrogenase
HMMPfam IPR006115 16 189 PF03446 6-phosphogluconate dehydrogenase
IPR006114 193 483 PF00393 6-phosphogluconate dehydrogenase
HMMTigr IPR006113 18 484 TIGR00873 6-phosphogluconate dehydrogenase
ScanRegExp IPR006184 267 279 PS00461 6-phosphogluconate-binding site
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp