ORK02197

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK02197

Order Kazusa clone(s) from :

Accession No
Product ID	ORK02197
Clone name	bm05765
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	DPF2
cDNA sequence	DNA sequence (2400 bp) Predicted protein sequence (392 aa)
HaloTag ORF Clone	FHC02197
Flexi ORF Clone	FXC02197
Description	Zinc finger protein ubi-d4 (Requiem) (Apoptosis response zinc finger protein) (D4, zinc and double PHD fingers family 2).

Features of the cloned cDNA sequence

Description

Length: 2400 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1220 bp
Genome contig ID	gi51511727f_64764432
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- TCTAAACATTAGTAAAAATAAATGTTTTTACACAG
Flanking genome sequence (112596 - 112645)	----+--------+--------+--------+--------+----* AGCCCTCTGCTGGATGGTTTATCTCCTGCCTTTCTCCATTAAGAAGGCCA

Features of the protein sequence

Description

Length: 392 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q92785	3.1e-153	100.0	Zinc finger pro...	Homo sapiens
AAP36655	3.1e-153	100.0	requiem, apopto...	synthetic construct
XP_001492666	6.9e-153	99.7	similar to Zinc...	Equus caballus
ABL07500	9.1e-153	99.7	zinc-finger pro...	Capra hircus
EDM12541	4e-152	99.2	D4, zinc and do...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007087	210	233	PF00096	Zinc finger
	IPR001965	273	331	PF00628	Zinc finger
	IPR001965	333	378	PF00628	Zinc finger
HMMSmart	IPR015880	210	233	SM00355	Zinc finger
	IPR001965	273	329	SM00249	Zinc finger
	IPR001965	330	376	SM00249	Zinc finger
ProfileScan	IPR007087	210	238	PS50157	Zinc finger
	IPR001965	271	331	PS50016	Zinc finger
	IPR001965	328	378	PS50016	Zinc finger
ScanRegExp	IPR007087	212	233	PS00028	Zinc finger
ScanRegExp	IPR001965	296	375	PS01359	Zinc finger

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp