ORK02199

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK02199

Order Kazusa clone(s) from :

Accession No
Product ID	ORK02199
Clone name	bm05945
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	HPCAL1
cDNA sequence	DNA sequence (1762 bp) Predicted protein sequence (199 aa)
HaloTag ORF Clone	FHC02199
Flexi ORF Clone	FXC02199
Description	Hippocalcin-like protein 1 (Visinin-like protein 3) (VILIP-3) (Calcium-binding protein BDR-1) (HLP2).

Features of the cloned cDNA sequence

Description

Length: 1762 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	780 bp
Genome contig ID	gi89161199f_10260529
PolyA signal sequence (ATTAAA,-16)	+--------+--------+----*----+---- TTGGTCTGGCATTTCCGGTATTAAAATGATAAAAT
Flanking genome sequence (224651 - 224700)	----+--------+--------+--------+--------+----* AAATGGCATTTTCTGAGTTTTGCGTCTGCCCGCGGGAGCCCCCATTCCTC

Features of the protein sequence

Description

Length: 199 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_852217	2.5e-81	98.9	similar to hipp...	Canis lupus fam...
P37235	1.7e-80	100.0	Hippocalcin-lik...	Homo sapiens
Q06AT0	3.2e-80	99.4	Hippocalcin-lik...	Sus scrofa
XP_001371965	7.1e-80	98.9	similar to Rem-...	Monodelphis dom...
EAX00963	1.2e-79	99.4	hippocalcin-lik...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR002048	105	177	PD000012	Calcium-binding EF-hand
FPrintScan	IPR001125	14	28	PR00450	Recoverin
	IPR001125	28	47	PR00450	Recoverin
	IPR001125	74	95	PR00450	Recoverin
	IPR001125	98	117	PR00450	Recoverin
	IPR001125	120	138	PR00450	Recoverin
	IPR001125	144	159	PR00450	Recoverin
	IPR001125	170	190	PR00450	Recoverin
HMMPfam	IPR002048	70	98	PF00036	Calcium-binding EF-hand
	IPR002048	106	134	PF00036	Calcium-binding EF-hand
	IPR002048	154	182	PF00036	Calcium-binding EF-hand
HMMSmart	IPR002048	70	98	SM00054	Calcium-binding EF-hand
	IPR002048	106	134	SM00054	Calcium-binding EF-hand
	IPR002048	154	182	SM00054	Calcium-binding EF-hand
ProfileScan	IPR002048	47	64	PS50222	Calcium-binding EF-hand
	IPR002048	66	101	PS50222	Calcium-binding EF-hand
	IPR002048	102	137	PS50222	Calcium-binding EF-hand
	IPR002048	150	185	PS50222	Calcium-binding EF-hand
ScanRegExp	IPR002048	79	91	PS00018	Calcium-binding EF-hand
	IPR002048	115	127	PS00018	Calcium-binding EF-hand
	IPR002048	163	175	PS00018	Calcium-binding EF-hand

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp