Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK02209
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK02209
Clone name eg00472
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol MCRS1
cDNA sequence DNA sequence (1907 bp)
Predicted protein sequence (483 aa)
Flexi ORF Clone FXC02209
Description Microspherule protein 1 (58 kDa microspherule protein) (Cell cycle- regulated factor p78) (MCRS2).
Features of the cloned cDNA sequence

Length: 1907 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 343 bp
Genome contig ID gi89161190r_48138350
PolyA signal sequence
(AATAAA,-25)
+----*----+----*----+----*----+----
TTCTTTTGTAAATAAAAAGCACCAGGTTCCAAAGT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AGTTTATTTTATTTTTTTTTTTTAATATAAAAATTTGGGGACAGGTAGAG

Features of the protein sequence

Length: 483 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
XP_509047 7.6e-162 97.4 microspherule p...
Pan troglodytes
Q96EZ8 2e-161 100.0 Microspherule p...
Homo sapiens
AAC52086 3.8e-161 99.7 nucleolar prote...
Homo sapiens
XP_001504261 1.2e-160 99.5 microspherule p...
Equus caballus
AAQ84517 2.1e-160 99.3 MCRS2 [Homo sap...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000253 384 457 PF00498 Forkhead-associated
HMMSmart IPR000253 383 440 SM00240 Forkhead-associated
ProfileScan IPR000253 384 440 PS50006 Forkhead-associated
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp