ORK02210

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK02210

Order Kazusa clone(s) from :

Accession No
Product ID	ORK02210
Clone name	ej00442
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	TAL1
cDNA sequence	DNA sequence (4841 bp) Predicted protein sequence (335 aa)
HaloTag ORF Clone	FHC02210
Flexi ORF Clone	FXC02210
Description	T-cell acute lymphocytic leukemia 1

Features of the cloned cDNA sequence

Description

Length: 4841 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	3430 bp
Genome contig ID	gi89161185r_47354550
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- CGGGAAGATTTCTAAATAAAAGTTTTACAAAGGGG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* CCTTAGGACTCTGTGCTTGCATTGCACCCCTAGGCCTGAGACGGGATATT

Features of the protein sequence

Description

Length: 335 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
P17542	5.6e-104	100.0	T-cell acute ly...	Homo sapiens
AAB19683	7.9e-104	99.6	TAL-1 [Homo sap...	Homo sapiens
XP_001163354	1.1e-103	99.6	T-cell acute ly...	Pan troglodytes
CAB72254	3.5e-102	98.4	SCL [Homo sapiens].	Homo sapiens
XP_596853	5.5e-97	94.2	similar to T-ce...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001092	192	244	PF00010	Basic helix-loop-helix dimerisation region bHLH
HMMSmart	IPR001092	197	249	SM00353	Basic helix-loop-helix dimerisation region bHLH
ProfileScan	IPR001092	192	244	PS50888	Basic helix-loop-helix dimerisation region bHLH

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp