Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK02215
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK02215
Clone name ek00118
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol AKT1
cDNA sequence DNA sequence (2625 bp)
Predicted protein sequence (492 aa)
Flexi ORF Clone FXC02215
Description RAC-alpha serine/threonine-protein kinase (EC 2.7.11.1) (RAC-PK-alpha) (Protein kinase B) (PKB) (C-AKT).
Features of the cloned cDNA sequence

Length: 2625 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 989 bp
Genome contig ID gi51511730r_104206734
PolyA signal sequence
(AATAAA,-17)		 
+----*----+----*----+----*----+----
CTTCCCTCCAAATTCTTCAATAAAAGTTGCTTTTC
Flanking genome sequence
(100000 - 99951)		 
----+----*----+----*----+----*----+----*----+----*
AAATTTTTGGCTCACTTTGCTGGGTGGAAGAGTGGGTGGCCAGGGAGGGA

Features of the protein sequence

Length: 492 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
P31749 7.7e-205 100.0 RAC-alpha serin...
 Homo sapiens
AAQ02456 7.7e-205 100.0 v-akt murine th...
 synthetic construct
AAA36539 2.6e-204 99.7 rac protein kin...
 Homo sapiens
AAX36962 2.6e-204 99.7 v-akt murine th...
 synthetic construct
BAG53786 6.4e-204 99.5 unnamed protein...
 Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR000719 162 420 PD000001 Protein kinase
HMMPfam IPR001849 18 120 PF00169 Pleckstrin-like
IPR000719 162 420 PF00069 Protein kinase
IPR000961 440 490 PF00433 Protein kinase
HMMSmart IPR001849 18 122 SM00233 Pleckstrin-like
IPR001245 162 420 SM00219 Tyrosine protein kinase
IPR002290 162 420 SM00220 Serine/threonine protein kinase
IPR000961 421 488 SM00133 Protein kinase
ProfileScan IPR001849 17 120 PS50003 Pleckstrin-like
IPR000719 162 420 PS50011 Protein kinase
ScanRegExp IPR000719 168 201 PS00107 Protein kinase
IPR008271 282 294 PS00108 Serine/threonine protein kinase
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp