ORK02216

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK02216

Order Kazusa clone(s) from :

Accession No
Product ID	ORK02216
Clone name	ek00160
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	SERPINE1
cDNA sequence	DNA sequence (3148 bp) Predicted protein sequence (445 aa)
HaloTag ORF Clone	FHC02216
Flexi ORF Clone	FXC02216
Description	Plasminogen activator inhibitor 1 precursor (PAI-1) (Endothelial plasminogen activator inhibitor) (PAI).

Features of the cloned cDNA sequence

Description

Length: 3148 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1809 bp
Genome contig ID	gi89161213f_100457117
PolyA signal sequence (AATAAA,-7)	+--------+--------+----*----+---- AAAAATGTTTCAAAAAAATAATAAAATAAATAAAT
Flanking genome sequence (112128 - 112177)	----+--------+--------+--------+--------+----* ACGAAGAATATGTCAGGACAGTCACTGCCTTCACCTTCTCCATTTCACAC

Features of the protein sequence

Description

Length: 445 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_527841	3.1e-187	99.3	hypothetical pr...	Pan troglodytes
P05121	9.6e-170	100.0	Plasminogen act...	Homo sapiens
AAX36888	9.6e-170	100.0	serine or cyste...	synthetic construct
AAA60009	1.8e-169	99.7	plasminogen act...	Homo sapiens
AAX43022	2.4e-169	99.7	serine or cyste...	synthetic construct

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000215	68	445	PF00079	Protease inhibitor I4
HMMSmart	IPR000215	83	445	SM00093	Protease inhibitor I4
ScanRegExp	IPR000215	418	428	PS00284	Protease inhibitor I4

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp