ORK02371

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK02371

Order Kazusa clone(s) from :

Accession No
Product ID	ORK02371
Clone name	sh04761
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	KLF11
cDNA sequence	DNA sequence (5715 bp) Predicted protein sequence (498 aa)
HaloTag ORF Clone	FHC02371
Flexi ORF Clone	FXC02371
Description	Krueppel-like factor 11 (Transforming growth factor-beta-inducible early growth response protein 2) (TGFB-inducible early growth response protein 2) (TIEG-2).

Features of the cloned cDNA sequence

Description

Length: 5715 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	2331 bp
Genome contig ID	gi89161199f_10001841
PolyA signal sequence (TATAAA,-22)	+--------+--------+----*----+---- TCTCTTTGAATCATATAAAACTTGATTTTACATTG
Flanking genome sequence (110575 - 110624)	----+--------+--------+--------+--------+----* GATGTGTGTCCTGTGTCATTTAACTGTACCTGGTGGCCTAAGTATACCTA

Features of the protein sequence

Description

Length: 498 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
O14901	1.2e-182	100.0	Krueppel-like f...	Homo sapiens
BAG37743	4.5e-182	99.5	unnamed protein...	Homo sapiens
EAX00972	1.2e-181	100.0	Kruppel-like fa...	Homo sapiens
XP_515296	6.8e-180	98.5	Kruppel-like fa...	Pan troglodytes
CAC06699	8e-178	97.9	TGFb inducible ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR007087	410	435	PD000003	Zinc finger
BlastProDom	IPR007087	440	462	PD000003	Zinc finger
HMMPfam	IPR007087	380	404	PF00096	Zinc finger
	IPR007087	410	434	PF00096	Zinc finger
	IPR007087	440	462	PF00096	Zinc finger
HMMSmart	IPR015880	380	404	SM00355	Zinc finger
	IPR015880	410	434	SM00355	Zinc finger
	IPR015880	440	462	SM00355	Zinc finger
ProfileScan	IPR007087	380	409	PS50157	Zinc finger
	IPR007087	410	439	PS50157	Zinc finger
	IPR007087	440	467	PS50157	Zinc finger
ScanRegExp	IPR007087	382	404	PS00028	Zinc finger
	IPR007087	412	434	PS00028	Zinc finger
	IPR007087	442	462	PS00028	Zinc finger

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp