ORK02509

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK02509

Order Kazusa clone(s) from :

Accession No
Product ID	ORK02509
Clone name	ah01915
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	RHOXF1
cDNA sequence	DNA sequence (6231 bp) Predicted protein sequence (207 aa)
HaloTag ORF Clone	FHC02509
Flexi ORF Clone	FXC02509
Description	Rhox homeobox family, member 1

Features of the cloned cDNA sequence

Description

Length: 6231 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	142 bp
Genome contig ID	gi89161218r_119027036
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- CTTATGTTATCAATAAAGAGGCAAATTCTCAATAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATTTGTTTTTGTGTGCCAATTGTGGTTAGTAGGGTATAGGTGCAAATTGT

Features of the protein sequence

Description

Length: 207 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q8NHV9	4.9e-62	100.0	Rhox homeobox f...	Homo sapiens
XP_001084578	3.7e-50	85.8	similar to pair...	Macaca mulatta
AAC78617	5.5e-48	100.0	match to EST AA...	Homo sapiens
AAI09513	1.6e-13	43.0	ESX homeobox 1 ...	Bos taurus
XP_538156	3e-12	48.1	similar to extr...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001356	126	183	PD000010	Homeobox
FPrintScan	IPR001356	148	159	PR00024	Homeobox
	IPR000047	155	164	PR00031	Helix-turn-helix motif
	IPR001356	163	173	PR00024	Homeobox
	IPR000047	164	180	PR00031	Helix-turn-helix motif
	IPR001356	173	182	PR00024	Homeobox
HMMPfam	IPR001356	127	183	PF00046	Homeobox
HMMSmart	IPR001356	126	188	SM00389	Homeobox
ProfileScan	IPR001356	124	184	PS50071	Homeobox
ScanRegExp	IPR001356	159	182	PS00027	Homeobox

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp