Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK02583
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK02583
Clone name bm01989
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol SAP18
cDNA sequence DNA sequence (1974 bp)
Predicted protein sequence (159 aa)
Flexi ORF Clone FXC02583
Description Sin3A-associated protein, 18kDa
Features of the cloned cDNA sequence

Length: 1974 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 1493 bp
Genome contig ID gi51511729f_20512730
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
AGAGGGTAGGAACTAAATAAAGGACTTTGTAAGCC
Flanking genome sequence
(108246 - 108295)
----+----*----+----*----+----*----+----*----+----*
AAAGTGGTTGGGCTGCTTTGTCAAATTCCACCCTTTGCTTGGTTCCAACA

Features of the protein sequence

Length: 159 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
NP_005861 1.2e-65 100.0 histone deacety...
Homo sapiens
XP_534536 4.3e-65 99.3 similar to sin3...
Canis lupus fam...
XP_532294 1.3e-64 98.1 similar to sin3...
Canis lupus fam...
NP_001030544 1.3e-64 98.7 histone deacety...
Bos taurus
EDM14358 7.7e-64 98.1 rCG23529, isofo...
Rattus norvegicus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom NULL 28 143 PD016033 NULL
HMMPfam IPR010516 22 143 PF06487 Sin3 associated polypeptide p18
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp