ORK02603

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK02603

Order Kazusa clone(s) from :

Accession No
Product ID	ORK02603
Clone name	bm06111
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	ZSCAN18
cDNA sequence	DNA sequence (2545 bp) Predicted protein sequence (564 aa)
HaloTag ORF Clone	FHC02603
Flexi ORF Clone	FXC02603
Description	zinc finger and SCAN domain containing 18

Features of the cloned cDNA sequence

Description

Length: 2545 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	848 bp
Genome contig ID	gi42406306r_63187016
PolyA signal sequence (ACTAAA,-25)	+--------+--------+----*----+---- AGCAAAGGAGACTAAACTCCTTGGGCTACATAAGG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TGATCTTTTCATTGATTGCATTTATTCTCAAGATTACAGTATCATTCCCA

Features of the protein sequence

Description

Length: 564 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_512943	3.9e-194	99.4	hypothetical pr...	Pan troglodytes
BAG57634	6.5e-190	99.8	unnamed protein...	Homo sapiens
Q8TBC5	8.2e-174	100.0	Zinc finger and...	Homo sapiens
BAB14332	2.1e-173	99.8	unnamed protein...	Homo sapiens
AAH22846	3e-173	99.8	Zinc finger and...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003309	97	192	PF02023	Transcriptional regulator SCAN
	IPR007087	467	489	PF00096	Zinc finger
	IPR007087	495	517	PF00096	Zinc finger
HMMSmart	IPR003309	99	211	SM00431	Transcriptional regulator SCAN
	IPR015880	467	489	SM00355	Zinc finger
	IPR015880	495	517	SM00355	Zinc finger
ProfileScan	IPR003309	103	181	PS50804	Transcriptional regulator SCAN
	IPR007087	467	494	PS50157	Zinc finger
	IPR007087	495	522	PS50157	Zinc finger
ScanRegExp	IPR007087	469	489	PS00028	Zinc finger
ScanRegExp	IPR007087	497	517	PS00028	Zinc finger

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp