Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK02607
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK02607
Clone name bm06678
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol LDB2
cDNA sequence DNA sequence (2284 bp)
Predicted protein sequence (353 aa)
Flexi ORF Clone FXC02607
Description LIM domain binding 2
Features of the cloned cDNA sequence

Length: 2284 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 1099 bp
Genome contig ID gi89161207r_16012265
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
GATAAGTGTGCCAATAATAAACTGTGTTAATGACC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAGCAAGTGAATCTGGCTATTTGTGTGAGTACGTGTGTAGCAATCTGCT

Features of the protein sequence

Length: 353 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAG73347 3.1e-142 100.0 LIM domain bind...
synthetic construct
XP_001161684 1.9e-140 99.4 LIM domain bind...
Pan troglodytes
XP_001505760 3.6e-71 89.4 similar to LIM ...
Ornithorhynchus...
XP_001363230 3.6e-71 89.8 similar to LIM ...
Monodelphis dom...
XP_002193978 4e-71 90.3 LIM domain bind...
Taeniopygia guttata
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR002691 9 353 PF01803 LIM binding protein
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp