Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK02635
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK02635
Clone name bm02679
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol SNCA
cDNA sequence DNA sequence (1775 bp)
Predicted protein sequence (145 aa)
Flexi ORF Clone FXC02635
Description synuclein, alpha (non A4 component of amyloid precursor)
Features of the cloned cDNA sequence

Length: 1775 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 1074 bp
Genome contig ID gi89161207r_90765728
PolyA signal sequence
(AATAAA,-21)		 
+----*----+----*----+----*----+----
TGTACCTTTCTGACAATAAATAATATTCGACCATG
Flanking genome sequence
(100000 - 99951)		 
----+----*----+----*----+----*----+----*----+----*
AATAAAAAAAAAAAAAAAGTGGGTTCCCGGGAACTAAGCAGTGTAGAAGA

Features of the protein sequence

Length: 145 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
P37840 1.9e-48 100.0 Alpha-synuclein...
 Homo sapiens
AAP36433 1.9e-48 100.0 synuclein, alph...
 synthetic construct
P61139 3.5e-48 99.2 Alpha-synuclein.
 Erythrocebus patas
P61143 4e-48 98.5 Alpha-synuclein.
 Macaca mulatta
P61146 9.7e-48 99.2 Alpha-synuclein.
 Pongo abelii
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR001058 6 42 PD010631 Synuclein
FPrintScan IPR001058 7 19 PR01211 Synuclein
IPR001058 19 33 PR01211 Synuclein
IPR001058 34 53 PR01211 Synuclein
IPR001058 54 77 PR01211 Synuclein
IPR002460 76 85 PR01212 Alpha-synuclein
IPR001058 89 104 PR01211 Synuclein
IPR002460 97 107 PR01212 Alpha-synuclein
IPR002460 108 122 PR01212 Alpha-synuclein
IPR002460 123 138 PR01212 Alpha-synuclein
HMMPfam IPR001058 6 137 PF01387 Synuclein
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp