Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK02636
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK02636
Clone name bm09917
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol MEIS3
cDNA sequence DNA sequence (1934 bp)
Predicted protein sequence (430 aa)
Flexi ORF Clone FXC02636
Description Homeobox protein Meis3 isoform 3
Features of the cloned cDNA sequence

Length: 1934 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 446 bp
Genome contig ID gi42406306r_52498194
PolyA signal sequence
(GATAAA,-21)
+----*----+----*----+----*----+----
TTCTTTTTTTTAATGATAAAGTCTTAAAAACACGG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AGCCACCAACTGGAGTTCTTGTGTCTATCCCAAGATTTCAAATTCTTACC

Features of the protein sequence

Length: 430 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
AAH69251 1.2e-127 100.0 Meis homeobox 3...
Homo sapiens
A8K0S8 8.9e-120 94.1 Putative homeob...
Homo sapiens
XP_001152907 1e-117 92.4 similar to Meis...
Pan troglodytes
AAH03762 9.3e-113 88.9 Meis3 protein [...
Mus musculus
AAM09846 3.6e-91 99.2 MEIS1-related p...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR001356 340 374 PD000010 Homeobox
HMMPfam IPR001356 318 377 PF00046 Homeobox
HMMSmart IPR001356 317 382 SM00389 Homeobox
ProfileScan IPR001356 315 378 PS50071 Homeobox
ScanRegExp IPR002345 418 430 PS00213 Lipocalin
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp