Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK02690
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK02690
Clone name bn04373
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol COPS5
cDNA sequence DNA sequence (1255 bp)
Predicted protein sequence (367 aa)
Flexi ORF Clone FXC02690
Description COP9 constitutive photomorphogenic homolog subunit 5 (Arabidopsis)
Features of the cloned cDNA sequence

Length: 1255 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 151 bp
Genome contig ID gi51511724r_68017871
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
AATATTAATATCCTGTAATAAAGCTCTTTAAAATG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAATTGTCCTTTGATTTTTTTGTGGGAAGATTCGCAATATTTTTCTAGTA

Features of the protein sequence

Length: 367 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q92905 2.4e-143 100.0 COP9 signalosom...
Homo sapiens
AAX37104 2.4e-143 100.0 COP9 constituti...
synthetic construct
AAP36860 2.4e-143 100.0 COP9 constituti...
synthetic construct
XP_535093 2.8e-143 99.7 similar to COP9...
Canis lupus fam...
XP_583747 2.8e-143 99.7 similar to COP9...
Bos taurus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR003639 90 172 PD363422 Mov34-1
HMMPfam IPR000555 83 197 PF01398 Mov34/MPN/PAD-1
HMMSmart IPR000555 87 224 SM00232 Mov34/MPN/PAD-1
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp