ORK02727

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK02727

Order Kazusa clone(s) from :

Accession No
Product ID	ORK02727
Clone name	fj13840
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	ELK3
cDNA sequence	DNA sequence (4046 bp) Predicted protein sequence (419 aa)
HaloTag ORF Clone	FHC02727
Flexi ORF Clone	FXC02727
Description	ELK3, ETS-domain protein (SRF accessory protein 2)

Features of the cloned cDNA sequence

Description

Length: 4046 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	2636 bp
Genome contig ID	gi89161190f_95012431
PolyA signal sequence (AATAAA,-17)	+--------+--------+----*----+---- GTCATATTATTTTTGTTCAATAAAAACTTTGTGAT
Flanking genome sequence (175296 - 175345)	----+--------+--------+--------+--------+----* AAAAGGTGTTTAGAGGTAACTGGATTGGCTTACTTCCATTTGCTTGGGGT

Features of the protein sequence

Description

Length: 419 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
P41970	5.5e-143	100.0	ETS domain-cont...	Homo sapiens
AAX29822	5.5e-143	100.0	ETS-domain prot...	synthetic construct
XP_001146300	9.4e-143	99.7	ELK3 protein is...	Pan troglodytes
CAG47047	1.8e-142	99.7	ELK3 [Homo sapi...	Homo sapiens
XP_001107872	2.1e-142	99.5	similar to ELK3...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000418	17	30	PR00454	Ets
	IPR000418	41	59	PR00454	Ets
	IPR000418	60	78	PR00454	Ets
	IPR000418	79	97	PR00454	Ets
HMMPfam	IPR000418	16	99	PF00178	Ets
HMMSmart	IPR000418	16	101	SM00413	Ets
ProfileScan	IPR000418	17	97	PS50061	Ets
ScanRegExp	IPR000418	19	27	PS00345	Ets
ScanRegExp	IPR000418	63	78	PS00346	Ets

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp