ORK02752

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK02752

Order Kazusa clone(s) from :

Accession No
Product ID	ORK02752
Clone name	af02858
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	ZBTB20
cDNA sequence	DNA sequence (2591 bp) Predicted protein sequence (747 aa)
HaloTag ORF Clone	FHC02752
Flexi ORF Clone	FXC02752
Description	zinc finger and BTB domain containing 20

Features of the cloned cDNA sequence

Description

Length: 2591 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	337 bp
Genome contig ID	gi89161205r_115440228
PolyA signal sequence (None)	+--------+--------+----*----+---- ACCCTTCTTTACAAAAAAATCTTTTAAAAAAAAGT
Flanking genome sequence (99977 - 99928)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAATTTCCACTTGTGAAGAGCACTACAAAAAATATAT

Features of the protein sequence

Description

Length: 747 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9HC78	100.0	Zinc finger and...	Homo sapiens
AAG28340	99.3	BTB/POZ zinc fi...	Homo sapiens
XP_848538	99.1	similar to Zinc...	Canis lupus fam...
XP_585702	98.3	similar to zinc...	Bos taurus
EDM11180	97.6	zinc finger and...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR007087	640	662	PD000003	Zinc finger
HMMPfam	IPR013069	100	203	PF00651	BTB/POZ
	IPR007087	584	606	PF00096	Zinc finger
	IPR007087	612	634	PF00096	Zinc finger
	IPR007087	640	662	PF00096	Zinc finger
	IPR007087	668	690	PF00096	Zinc finger
	IPR007087	721	743	PF00096	Zinc finger
HMMSmart	IPR000210	110	203	SM00225	BTB/POZ-like
	IPR015880	584	606	SM00355	Zinc finger
	IPR015880	612	634	SM00355	Zinc finger
	IPR015880	640	662	SM00355	Zinc finger
	IPR015880	668	690	SM00355	Zinc finger
	IPR015880	721	743	SM00355	Zinc finger
ProfileScan	IPR000210	110	173	PS50097	BTB/POZ-like
	IPR007087	584	611	PS50157	Zinc finger
	IPR007087	612	639	PS50157	Zinc finger
	IPR007087	640	667	PS50157	Zinc finger
	IPR007087	668	695	PS50157	Zinc finger
	IPR007087	721	747	PS50157	Zinc finger
ScanRegExp	IPR007087	586	606	PS00028	Zinc finger
	IPR007087	614	634	PS00028	Zinc finger
	IPR007087	642	662	PS00028	Zinc finger
	IPR007087	670	690	PS00028	Zinc finger
	IPR007087	723	743	PS00028	Zinc finger

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp