Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK02799
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK02799
Clone name ee13635
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol TFCP2
cDNA sequence DNA sequence (3370 bp)
Predicted protein sequence (522 aa)
Flexi ORF Clone FXC02799
Description transcription factor CP2
Features of the cloned cDNA sequence

Length: 3370 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 1471 bp
Genome contig ID gi89161190r_49673818
PolyA signal sequence
(ATTAAA,-16)
+----*----+----*----+----*----+----
TATACAGAGATTTTTGTTCATTAAACTCAATCTGC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATCATGGTCTAATTTCTCTTGGTTTGAAACAAATTGAAAACTTTGAAACC

Features of the protein sequence

Length: 522 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q12800 3.5e-193 100.0 Alpha-globin tr...
Homo sapiens
AAA21324 8e-193 99.8 transcription f...
Homo sapiens
XP_001087537 1.2e-192 99.8 similar to tran...
Macaca mulatta
EAW58178 3.6e-192 99.8 transcription f...
Homo sapiens
XP_534801 3.6e-192 99.8 similar to tran...
Canis lupus fam...
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR007604 57 284 PF04516 CP2 transcription factor
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp