ORK02820

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK02820

Order Kazusa clone(s) from :

Accession No
Product ID	ORK02820
Clone name	hk01536
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	ZNF664
cDNA sequence	DNA sequence (4228 bp) Predicted protein sequence (283 aa)
HaloTag ORF Clone	FHC02820
Flexi ORF Clone	FXC02820
Description	zinc finger protein 664

Features of the cloned cDNA sequence

Description

Length: 4228 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	2497 bp
Genome contig ID	gi89161190f_122923763
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- CCAAATCAATTTAATAAAATCGCTTTATAACAGGG
Flanking genome sequence (142166 - 142215)	----+--------+--------+--------+--------+----* TTCTGTGCTTGACATGTAGTTGTGTGAATTCAGTGGTCGTGTGTGGGAGT

Features of the protein sequence

Description

Length: 283 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q8N3J9	6.6e-115	100.0	Zinc finger pro...	Homo sapiens
Q60493	1.8e-114	99.2	Zinc finger pro...	Cavia porcellus
Q4VA44	3.8e-114	99.6	Zinc finger pro...	Mus musculus
XP_522549	4.4e-114	99.2	similar to Zinc...	Pan troglodytes
Q5RAM9	5.1e-114	99.6	Zinc finger pro...	Pongo abelii

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR007087	81	104	PD000003	Zinc finger
	IPR007087	109	132	PD000003	Zinc finger
	IPR007087	137	160	PD000003	Zinc finger
	IPR007087	165	188	PD000003	Zinc finger
	IPR007087	193	216	PD000003	Zinc finger
	IPR007087	221	244	PD000003	Zinc finger
	IPR007087	249	272	PD000003	Zinc finger
HMMPfam	IPR007087	25	47	PF00096	Zinc finger
	IPR007087	53	75	PF00096	Zinc finger
	IPR007087	81	103	PF00096	Zinc finger
	IPR007087	109	131	PF00096	Zinc finger
	IPR007087	137	159	PF00096	Zinc finger
	IPR007087	165	187	PF00096	Zinc finger
	IPR007087	193	215	PF00096	Zinc finger
	IPR007087	221	243	PF00096	Zinc finger
	IPR007087	249	271	PF00096	Zinc finger
HMMSmart	IPR015880	25	47	SM00355	Zinc finger
	IPR015880	53	75	SM00355	Zinc finger
	IPR015880	81	103	SM00355	Zinc finger
	IPR015880	109	131	SM00355	Zinc finger
	IPR015880	137	159	SM00355	Zinc finger
	IPR015880	165	187	SM00355	Zinc finger
	IPR015880	193	215	SM00355	Zinc finger
	IPR015880	221	243	SM00355	Zinc finger
	IPR015880	249	271	SM00355	Zinc finger
ProfileScan	IPR007087	25	52	PS50157	Zinc finger
	IPR007087	53	80	PS50157	Zinc finger
	IPR007087	81	108	PS50157	Zinc finger
	IPR007087	109	136	PS50157	Zinc finger
	IPR007087	137	164	PS50157	Zinc finger
	IPR007087	165	192	PS50157	Zinc finger
	IPR007087	193	220	PS50157	Zinc finger
	IPR007087	221	248	PS50157	Zinc finger
	IPR007087	249	276	PS50157	Zinc finger
ScanRegExp	IPR007087	27	47	PS00028	Zinc finger
	IPR007087	55	75	PS00028	Zinc finger
	IPR007087	83	103	PS00028	Zinc finger
	IPR007087	111	131	PS00028	Zinc finger
	IPR007087	139	159	PS00028	Zinc finger
	IPR007087	167	187	PS00028	Zinc finger
	IPR007087	195	215	PS00028	Zinc finger
	IPR007087	223	243	PS00028	Zinc finger
	IPR007087	251	271	PS00028	Zinc finger

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp