Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK02880
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK02880
Clone name fh11504
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol RNF146
cDNA sequence DNA sequence (5648 bp)
Predicted protein sequence (370 aa)
Flexi ORF Clone FXC02880
Description ring finger protein 146
Features of the cloned cDNA sequence

Length: 5648 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 865 bp
Genome contig ID gi89161210f_127545757
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
TAGGCAGTGTGTATATAATAAACATGTATGGAAAT
Flanking genome sequence
(105641 - 105690)
----+----*----+----*----+----*----+----*----+----*
AAAACTAAAGCCTGTGAGACTTAAAATTCCTCAAATAGCATATACCGTTA

Features of the protein sequence

Length: 370 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
EAW48110 1.9e-138 100.0 ring finger pro...
Homo sapiens
CAB76255 2.1e-134 100.0 dactilydin [Hom...
Homo sapiens
Q9NTX7 2.1e-134 100.0 RING finger pro...
Homo sapiens
BAB55359 3.2e-134 99.7 unnamed protein...
Homo sapiens
Q5REL3 7.2e-134 99.7 RING finger pro...
Pongo abelii
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR001841 48 85 PF00097 Zinc finger
IPR004170 104 179 PF02825 WWE
HMMSmart IPR001841 48 85 SM00184 Zinc finger
IPR004170 112 187 SM00678 WWE
ProfileScan IPR001841 48 86 PS50089 Zinc finger
IPR004170 103 179 PS50918 WWE
ScanRegExp IPR001841 63 72 PS00518 Zinc finger
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp