Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK02905
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK02905
Clone name bm00978
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol SPOP
cDNA sequence DNA sequence (1267 bp)
Predicted protein sequence (374 aa)
Flexi ORF Clone FXC02905
Description speckle-type POZ protein
Features of the cloned cDNA sequence

Length: 1267 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 142 bp
Genome contig ID gi51511734r_44932597
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
TGAGGGGAAGAGACTGCATTGTGGCCCCAGACTTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
TAAAACAGCACTAAATAACTTGGGGGAAACGGGGGGAGGGAAAATGAAAT

Features of the protein sequence

Length: 374 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
O43791 2.1e-165 100.0 Speckle-type PO...
Homo sapiens
EDL15982 2.1e-165 100.0 speckle-type PO...
Mus musculus
CAH93220 2.4e-165 99.7 hypothetical pr...
Pongo abelii
XP_423281 2.8e-165 99.7 similar to SPOP...
Gallus gallus
BAE38870 4.6e-165 99.7 unnamed protein...
Mus musculus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR002083 38 163 PF00917 MATH
IPR013069 190 297 PF00651 BTB/POZ
HMMSmart IPR002083 36 142 SM00061 MATH
IPR000210 200 297 SM00225 BTB/POZ-like
ProfileScan IPR002083 31 161 PS50144 MATH
IPR000210 200 262 PS50097 BTB/POZ-like
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp