Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK02973
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK02973
Clone name fk11940
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol ZNF569
cDNA sequence DNA sequence (3613 bp)
Predicted protein sequence (701 aa)
Flexi ORF Clone FXC02973
Description Zinc finger protein 569.
Features of the cloned cDNA sequence

Length: 3613 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 1447 bp
Genome contig ID gi42406306r_42493893
PolyA signal sequence
(AATAAA,-26)		 
+----*----+----*----+----*----+----
TATTTCTTTAATAAAAGAGTGAAAGCAAATATGAC
Flanking genome sequence
(100000 - 99951)		 
----+----*----+----*----+----*----+----*----+----*
AGTGGTGACAAATCTGGTTGTCCAAATTAATTATATGGGTTTTTAAAATT

Features of the protein sequence

Length: 701 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
EAW56731 0 100.0 zinc finger pro...
 Homo sapiens
Q5MCW4 0 100.0 Zinc finger pro...
 Homo sapiens
XP_001494160 0 92.5 zinc finger pro...
 Equus caballus
XP_869959 0 91.6 zinc finger pro...
 Bos taurus
EDM07810 0 84.8 zinc finger pro...
 Rattus norvegicus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR007087 201 224 PD000003 Zinc finger
IPR007087 257 280 PD000003 Zinc finger
IPR007087 285 308 PD000003 Zinc finger
IPR007087 313 336 PD000003 Zinc finger
IPR007087 341 364 PD000003 Zinc finger
IPR007087 369 392 PD000003 Zinc finger
IPR007087 397 420 PD000003 Zinc finger
IPR007087 425 448 PD000003 Zinc finger
IPR007087 453 476 PD000003 Zinc finger
IPR007087 481 504 PD000003 Zinc finger
IPR007087 509 532 PD000003 Zinc finger
IPR007087 537 560 PD000003 Zinc finger
IPR007087 565 588 PD000003 Zinc finger
IPR007087 593 616 PD000003 Zinc finger
IPR007087 621 644 PD000003 Zinc finger
IPR007087 649 672 PD000003 Zinc finger
IPR007087 677 700 PD000003 Zinc finger
HMMPfam IPR001909 23 63 PF01352 KRAB box
IPR007087 201 223 PF00096 Zinc finger
IPR007087 229 251 PF00096 Zinc finger
IPR007087 257 279 PF00096 Zinc finger
IPR007087 285 307 PF00096 Zinc finger
IPR007087 313 335 PF00096 Zinc finger
IPR007087 341 363 PF00096 Zinc finger
IPR007087 369 391 PF00096 Zinc finger
IPR007087 397 419 PF00096 Zinc finger
IPR007087 425 447 PF00096 Zinc finger
IPR007087 453 475 PF00096 Zinc finger
IPR007087 481 503 PF00096 Zinc finger
IPR007087 509 531 PF00096 Zinc finger
IPR007087 537 559 PF00096 Zinc finger
IPR007087 565 587 PF00096 Zinc finger
IPR007087 593 615 PF00096 Zinc finger
IPR007087 621 643 PF00096 Zinc finger
IPR007087 649 671 PF00096 Zinc finger
IPR007087 677 699 PF00096 Zinc finger
HMMSmart IPR001909 23 83 SM00349 KRAB box
IPR015880 201 223 SM00355 Zinc finger
IPR015880 229 251 SM00355 Zinc finger
IPR015880 257 279 SM00355 Zinc finger
IPR015880 285 307 SM00355 Zinc finger
IPR015880 313 335 SM00355 Zinc finger
IPR015880 341 363 SM00355 Zinc finger
IPR015880 369 391 SM00355 Zinc finger
IPR015880 397 419 SM00355 Zinc finger
IPR015880 425 447 SM00355 Zinc finger
IPR015880 453 475 SM00355 Zinc finger
IPR015880 481 503 SM00355 Zinc finger
IPR015880 509 531 SM00355 Zinc finger
IPR015880 537 559 SM00355 Zinc finger
IPR015880 565 587 SM00355 Zinc finger
IPR015880 593 615 SM00355 Zinc finger
IPR015880 621 643 SM00355 Zinc finger
IPR015880 649 671 SM00355 Zinc finger
IPR015880 677 699 SM00355 Zinc finger
ProfileScan IPR001909 23 94 PS50805 KRAB box
IPR007087 201 228 PS50157 Zinc finger
IPR007087 229 256 PS50157 Zinc finger
IPR007087 257 284 PS50157 Zinc finger
IPR007087 285 312 PS50157 Zinc finger
IPR007087 313 340 PS50157 Zinc finger
IPR007087 341 368 PS50157 Zinc finger
IPR007087 369 396 PS50157 Zinc finger
IPR007087 397 424 PS50157 Zinc finger
IPR007087 425 452 PS50157 Zinc finger
IPR007087 453 480 PS50157 Zinc finger
IPR007087 481 508 PS50157 Zinc finger
IPR007087 509 536 PS50157 Zinc finger
IPR007087 537 564 PS50157 Zinc finger
IPR007087 565 592 PS50157 Zinc finger
IPR007087 593 620 PS50157 Zinc finger
IPR007087 621 648 PS50157 Zinc finger
IPR007087 649 676 PS50157 Zinc finger
IPR007087 677 701 PS50157 Zinc finger
ScanRegExp IPR007087 203 223 PS00028 Zinc finger
IPR007087 231 251 PS00028 Zinc finger
IPR007087 259 279 PS00028 Zinc finger
IPR007087 287 307 PS00028 Zinc finger
IPR007087 315 335 PS00028 Zinc finger
IPR007087 343 363 PS00028 Zinc finger
IPR007087 371 391 PS00028 Zinc finger
IPR007087 399 419 PS00028 Zinc finger
IPR007087 427 447 PS00028 Zinc finger
IPR007087 455 475 PS00028 Zinc finger
IPR007087 483 503 PS00028 Zinc finger
IPR007087 511 531 PS00028 Zinc finger
IPR007087 539 559 PS00028 Zinc finger
IPR007087 567 587 PS00028 Zinc finger
IPR007087 595 615 PS00028 Zinc finger
IPR007087 623 643 PS00028 Zinc finger
IPR007087 651 671 PS00028 Zinc finger
IPR007087 679 701 PS00028 Zinc finger
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp