ORK02974

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK02974

Order Kazusa clone(s) from :

Accession No
Product ID	ORK02974
Clone name	ff01534
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	TOX3
cDNA sequence	DNA sequence (4455 bp) Predicted protein sequence (600 aa)
HaloTag ORF Clone	FHC02974
Flexi ORF Clone	FXC02974
Description	TOX high mobility group box family member 3 (Trinucleotide repeat- containing protein 9) (CAG trinucleotide repeat-containing protein F9).

Features of the cloned cDNA sequence

Description

Length: 4455 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	2561 bp
Genome contig ID	gi51511732r_50928143
PolyA signal sequence (GATAAA,-8)	+--------+--------+----*----+---- GGGTTTTAGCAGCATTTAATCAAATGTGATAAAAC
Flanking genome sequence (310157 - 310108)	----+--------+--------+--------+--------+----* TAGAGAATGGGAACAGAATCCATACCAGATAATTAAATAGAGGGGAATTA

Features of the protein sequence

Description

Length: 600 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
O15405	2e-153	100.0	TOX high mobili...	Homo sapiens
XP_001165206	1.2e-152	99.6	similar to Trin...	Pan troglodytes
AAI67799	1.9e-152	100.0	TOX high mobili...	synthetic construct
XP_510963	1.1e-151	99.6	similar to Trin...	Pan troglodytes
Q80W03	4.3e-145	94.9	TOX high mobili...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000135	294	312	PR00886	High mobility group box HMG1 and HMG2
	IPR000135	312	331	PR00886	High mobility group box HMG1 and HMG2
	IPR000135	331	351	PR00886	High mobility group box HMG1 and HMG2
HMMPfam	IPR000910	279	347	PF00505	HMG1/2 (high mobility group) box
HMMSmart	IPR000910	278	348	SM00398	HMG1/2 (high mobility group) box
ProfileScan	IPR000910	279	347	PS50118	HMG1/2 (high mobility group) box

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp