Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK02976
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK02976
Clone name eg01310
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol ZNF514
cDNA sequence DNA sequence (6608 bp)
Predicted protein sequence (412 aa)
Flexi ORF Clone FXC02976
Description Zinc finger protein 514.
Features of the cloned cDNA sequence

Length: 6608 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 1074 bp
Genome contig ID gi89161199r_95077680
PolyA signal sequence
(AATAAA,-18)
+----*----+----*----+----*----+----
AGTCGTATTTTAGAGCTAATAAAACTGATGTTCAG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAGTGACATGCCTTGGCCTATAGTCCTAACTGGGCTGGGCCTCTTTCCT

Features of the protein sequence

Length: 412 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q96K75 3.7e-177 100.0 Zinc finger pro...
Homo sapiens
XP_525812 3.6e-175 99.0 hypothetical pr...
Pan troglodytes
XP_001093753 3.8e-169 95.5 similar to zinc...
Macaca mulatta
XP_001494489 4e-152 86.7 zinc finger pro...
Equus caballus
XP_854460 4.5e-143 81.1 similar to zinc...
Canis lupus fam...
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR007087 217 239 PD000003 Zinc finger
IPR007087 244 267 PD000003 Zinc finger
IPR007087 272 295 PD000003 Zinc finger
IPR007087 300 323 PD000003 Zinc finger
IPR007087 328 351 PD000003 Zinc finger
IPR007087 356 379 PD000003 Zinc finger
IPR007087 384 406 PD000003 Zinc finger
HMMPfam IPR001909 13 53 PF01352 KRAB box
IPR007087 216 238 PF00096 Zinc finger
IPR007087 244 266 PF00096 Zinc finger
IPR007087 272 294 PF00096 Zinc finger
IPR007087 300 322 PF00096 Zinc finger
IPR007087 328 350 PF00096 Zinc finger
IPR007087 356 378 PF00096 Zinc finger
IPR007087 384 406 PF00096 Zinc finger
HMMSmart IPR001909 13 73 SM00349 KRAB box
IPR015880 216 238 SM00355 Zinc finger
IPR015880 244 266 SM00355 Zinc finger
IPR015880 272 294 SM00355 Zinc finger
IPR015880 300 322 SM00355 Zinc finger
IPR015880 328 350 SM00355 Zinc finger
IPR015880 356 378 SM00355 Zinc finger
IPR015880 384 406 SM00355 Zinc finger
ProfileScan IPR001909 13 84 PS50805 KRAB box
IPR007087 216 243 PS50157 Zinc finger
IPR007087 244 271 PS50157 Zinc finger
IPR007087 272 299 PS50157 Zinc finger
IPR007087 300 327 PS50157 Zinc finger
IPR007087 328 355 PS50157 Zinc finger
IPR007087 356 383 PS50157 Zinc finger
IPR007087 384 411 PS50157 Zinc finger
ScanRegExp IPR007087 216 238 PS00028 Zinc finger
IPR007087 246 266 PS00028 Zinc finger
IPR007087 274 294 PS00028 Zinc finger
IPR007087 302 322 PS00028 Zinc finger
IPR007087 330 350 PS00028 Zinc finger
IPR007087 358 378 PS00028 Zinc finger
IPR007087 386 406 PS00028 Zinc finger
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp