Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK03139
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK03139
Clone name hj08120
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol MAPK10
cDNA sequence DNA sequence (5144 bp)
Predicted protein sequence (444 aa)
Flexi ORF Clone FXC03139
Description Mitogen-activated protein kinase 10 (EC 2.7.11.24) (Stress-activated protein kinase JNK3) (c-Jun N-terminal kinase 3) (MAP kinase p49 3F12).
Features of the cloned cDNA sequence

Length: 5144 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 3227 bp
Genome contig ID gi89161207r_87054178
PolyA signal sequence
(ATTAAA,-33)
+----*----+----*----+----*----+----
AAATTAAACTGCTGCAAGAGTTTGGCAAAACCGCC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ACCACTTTACTATTAATATGTCTTTACTATTTTTATATGTGTTTTGTGGG

Features of the protein sequence

Length: 444 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
XP_535641 9.2e-172 99.7 similar to mito...
Canis lupus fam...
P53779 9.2e-172 99.7 Mitogen-activat...
Homo sapiens
EDL20251 1.8e-171 99.5 mitogen activat...
Mus musculus
XP_001495292 3.3e-171 99.5 mitogen-activat...
Equus caballus
BAC31240 8.7e-171 99.3 unnamed protein...
Mus musculus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR000719 47 292 PD000001 Protein kinase
FPrintScan IPR008351 94 103 PR01772 JNK MAP kinase
IPR008351 130 145 PR01772 JNK MAP kinase
IPR008351 153 164 PR01772 JNK MAP kinase
IPR008351 191 201 PR01772 JNK MAP kinase
IPR008351 216 226 PR01772 JNK MAP kinase
IPR008351 251 263 PR01772 JNK MAP kinase
IPR008351 279 295 PR01772 JNK MAP kinase
IPR008351 298 322 PR01772 JNK MAP kinase
IPR008351 342 353 PR01772 JNK MAP kinase
HMMPfam IPR000719 44 339 PF00069 Protein kinase
HMMSmart IPR001245 44 293 SM00219 Tyrosine protein kinase
IPR002290 44 339 SM00220 Serine/threonine protein kinase
ProfileScan IPR000719 44 339 PS50011 Protein kinase
ScanRegExp IPR003527 79 181 PS01351 MAP kinase
IPR008271 165 177 PS00108 Serine/threonine protein kinase
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp