ORK03139

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK03139

Order Kazusa clone(s) from :

Accession No
Product ID	ORK03139
Clone name	hj08120
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	MAPK10
cDNA sequence	DNA sequence (5144 bp) Predicted protein sequence (444 aa)
HaloTag ORF Clone	FHC03139
Flexi ORF Clone	FXC03139
Description	Mitogen-activated protein kinase 10 (EC 2.7.11.24) (Stress-activated protein kinase JNK3) (c-Jun N-terminal kinase 3) (MAP kinase p49 3F12).

Features of the cloned cDNA sequence

Description

Length: 5144 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	3227 bp
Genome contig ID	gi89161207r_87054178
PolyA signal sequence (ATTAAA,-33)	+--------+--------+----*----+---- AAATTAAACTGCTGCAAGAGTTTGGCAAAACCGCC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACCACTTTACTATTAATATGTCTTTACTATTTTTATATGTGTTTTGTGGG

Features of the protein sequence

Description

Length: 444 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_535641	9.2e-172	99.7	similar to mito...	Canis lupus fam...
P53779	9.2e-172	99.7	Mitogen-activat...	Homo sapiens
EDL20251	1.8e-171	99.5	mitogen activat...	Mus musculus
XP_001495292	3.3e-171	99.5	mitogen-activat...	Equus caballus
BAC31240	8.7e-171	99.3	unnamed protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	47	292	PD000001	Protein kinase
FPrintScan	IPR008351	94	103	PR01772	JNK MAP kinase
	IPR008351	130	145	PR01772	JNK MAP kinase
	IPR008351	153	164	PR01772	JNK MAP kinase
	IPR008351	191	201	PR01772	JNK MAP kinase
	IPR008351	216	226	PR01772	JNK MAP kinase
	IPR008351	251	263	PR01772	JNK MAP kinase
	IPR008351	279	295	PR01772	JNK MAP kinase
	IPR008351	298	322	PR01772	JNK MAP kinase
	IPR008351	342	353	PR01772	JNK MAP kinase
HMMPfam	IPR000719	44	339	PF00069	Protein kinase
HMMSmart	IPR001245	44	293	SM00219	Tyrosine protein kinase
HMMSmart	IPR002290	44	339	SM00220	Serine/threonine protein kinase
ProfileScan	IPR000719	44	339	PS50011	Protein kinase
ScanRegExp	IPR003527	79	181	PS01351	MAP kinase
ScanRegExp	IPR008271	165	177	PS00108	Serine/threonine protein kinase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp