ORK03142

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK03142

Order Kazusa clone(s) from :

Accession No	AB290177
Product ID	ORK03142
Clone name	pj01764s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	MYO1E
cDNA sequence	DNA sequence (4703 bp) Predicted protein sequence (1135 aa)
HaloTag ORF Clone	FHC03142
Flexi ORF Clone	FXC03142
Description	myosin IE

Features of the cloned cDNA sequence

Description

Length: 4703 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1021 bp
Genome contig ID	gi51511731r_57115850
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- CTCCTAAATAAATAAAGGAATCGGCGAACACCTTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TTCTTTTATGACATTTGTTATGGGTTGAATTGTGTGCCTCCAAAGAAGAT

Features of the protein sequence

Description

Length: 1135 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q12965	100.0	Myosin-Ie; Myos...	Homo sapiens
XP_510448	99.6	myosin IE isofo...	Pan troglodytes
AAA62667	99.4	myosin-IC [Homo...	Homo sapiens
XP_535500	98.1	similar to myos...	Canis lupus fam...
AAH51391	96.2	Myosin IE [Mus ...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001609	170	205	PD000355	Myosin head
BlastProDom	IPR001452	1084	1133	PD000066	Src homology-3
FPrintScan	IPR001609	76	95	PR00193	Myosin head
	IPR001609	132	157	PR00193	Myosin head
	IPR001609	178	205	PR00193	Myosin head
	IPR001609	410	438	PR00193	Myosin head
	IPR001609	463	491	PR00193	Myosin head
	IPR001452	1081	1091	PR00452	Src homology-3
	IPR001452	1095	1110	PR00452	Src homology-3
	IPR001452	1112	1121	PR00452	Src homology-3
	IPR001452	1123	1135	PR00452	Src homology-3
HMMPfam	IPR001609	48	706	PF00063	Myosin head
	IPR000048	723	743	PF00612	IQ calmodulin-binding region
	IPR010926	745	950	PF06017	Myosin tail 2
	IPR001452	1081	1135	PF00018	Src homology-3
HMMSmart	IPR001609	40	720	SM00242	Myosin head
HMMSmart	IPR001452	1081	1135	SM00326	Src homology-3
ProfileScan	IPR000048	722	751	PS50096	IQ calmodulin-binding region
ProfileScan	IPR001452	1078	1135	PS50002	Src homology-3

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp