ORK03166

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK03166

Order Kazusa clone(s) from :

Accession No
Product ID	ORK03166
Clone name	af32513
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	CSPG4
cDNA sequence	DNA sequence (7999 bp) Predicted protein sequence (2357 aa)
HaloTag ORF Clone	FHC03166
Flexi ORF Clone	FXC03166
Description	Chondroitin sulfate proteoglycan 4 precursor (Chondroitin sulfate proteoglycan NG2) (Melanoma chondroitin sulfate proteoglycan) (Melanoma-associated chondroitin sulfate proteoglycan).

Features of the cloned cDNA sequence

Description

Length: 7999 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	923 bp
Genome contig ID	gi51511731r_73654023
PolyA signal sequence (GATAAA,-23)	+--------+--------+----*----+---- CCATGGAGCCTGGATAAACAGTGCTTTGGAGGCTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TGGACAGCTGTGTGGTGTTTGTGTCTTAACTATGCACTGGGCCCTTGTCT

Features of the protein sequence

Description

Length: 2357 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW99239	100.0	chondroitin sul...	Homo sapiens
Q6UVK1	99.9	Chondroitin sul...	Homo sapiens
CAA65529	99.4	melanoma-associ...	Homo sapiens
XP_001144835	97.7	melanoma-associ...	Pan troglodytes
XP_001493494	89.4	chondroitin sul...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR012679	90	216	PF00054	Laminin G
HMMPfam	IPR012680	265	398	PF02210	Laminin G
HMMSmart	IPR001791	82	213	SM00282	Laminin G
HMMSmart	IPR001791	257	398	SM00282	Laminin G
ProfileScan	IPR001791	64	227	PS50025	Laminin G
ProfileScan	IPR001791	237	415	PS50025	Laminin G
ScanRegExp	IPR000194	1335	1344	PS00152	ATPase

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	2252	FLEANMFSVIIPMCLVLLLLALI	2274	PRIMARY	23