Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK03168
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK03168
Clone name ah04379
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol ZFX
cDNA sequence DNA sequence (5633 bp)
Predicted protein sequence (809 aa)
Flexi ORF Clone FXC03168
Description Zinc finger X-chromosomal protein.
Features of the cloned cDNA sequence

Length: 5633 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 3133 bp
Genome contig ID gi89161218f_23980815
PolyA signal sequence
(AATAAA,-21)		 
+----*----+----*----+----*----+----
GTTTTTGTAAACCTAATAAACATCAAAAGCAGTGG
Flanking genome sequence
(161732 - 161781)		 
----+----*----+----*----+----*----+----*----+----*
ATTATTTTCATCCCCCCATTTCTTAATTTCTTTTTCACAGCAGTGGAATG

Features of the protein sequence

Length: 809 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
P17010 0 100.0 Zinc finger X-c...
 Homo sapiens
AAA61309 0 99.8 zinc finger pro...
 Homo sapiens
CAA42417 0 99.5 ZFX product, is...
 Homo sapiens
XP_520979 0 99.5 zinc finger pro...
 Pan troglodytes
XP_001090480 0 99.5 zinc finger pro...
 Macaca mulatta
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR007087 552 575 PD000003 Zinc finger
HMMPfam IPR006794 73 414 PF04704 Zfx / Zfy transcription activation region
IPR007087 429 451 PF00096 Zinc finger
IPR007087 460 482 PF00096 Zinc finger
IPR007087 492 514 PF00096 Zinc finger
IPR007087 523 546 PF00096 Zinc finger
IPR007087 552 574 PF00096 Zinc finger
IPR007087 580 603 PF00096 Zinc finger
IPR007087 609 631 PF00096 Zinc finger
IPR007087 637 660 PF00096 Zinc finger
IPR007087 666 688 PF00096 Zinc finger
IPR007087 723 745 PF00096 Zinc finger
IPR007087 751 774 PF00096 Zinc finger
IPR007087 780 802 PF00096 Zinc finger
HMMSmart IPR015880 429 451 SM00355 Zinc finger
IPR015880 460 482 SM00355 Zinc finger
IPR015880 492 514 SM00355 Zinc finger
IPR015880 523 546 SM00355 Zinc finger
IPR015880 552 574 SM00355 Zinc finger
IPR015880 580 603 SM00355 Zinc finger
IPR015880 609 631 SM00355 Zinc finger
IPR015880 637 660 SM00355 Zinc finger
IPR015880 666 688 SM00355 Zinc finger
IPR015880 694 717 SM00355 Zinc finger
IPR015880 723 745 SM00355 Zinc finger
IPR015880 751 774 SM00355 Zinc finger
IPR015880 780 802 SM00355 Zinc finger
ProfileScan IPR007087 429 459 PS50157 Zinc finger
IPR007087 460 482 PS50157 Zinc finger
IPR007087 492 519 PS50157 Zinc finger
IPR007087 523 551 PS50157 Zinc finger
IPR007087 552 579 PS50157 Zinc finger
IPR007087 580 608 PS50157 Zinc finger
IPR007087 609 636 PS50157 Zinc finger
IPR007087 637 665 PS50157 Zinc finger
IPR007087 666 693 PS50157 Zinc finger
IPR007087 694 722 PS50157 Zinc finger
IPR007087 723 750 PS50157 Zinc finger
IPR007087 751 779 PS50157 Zinc finger
IPR007087 780 807 PS50157 Zinc finger
ScanRegExp IPR007087 431 451 PS00028 Zinc finger
IPR007087 494 514 PS00028 Zinc finger
IPR007087 554 574 PS00028 Zinc finger
IPR007087 611 631 PS00028 Zinc finger
IPR007087 668 688 PS00028 Zinc finger
IPR007087 696 717 PS00028 Zinc finger
IPR007087 725 745 PS00028 Zinc finger
IPR007087 782 803 PS00028 Zinc finger
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp