ORK03170

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK03170

Order Kazusa clone(s) from :

Accession No
Product ID	ORK03170
Clone name	fj00939
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	POU2F1
cDNA sequence	DNA sequence (2902 bp) Predicted protein sequence (793 aa)
HaloTag ORF Clone	FHC03170
Flexi ORF Clone	FXC03170
Description	POU domain, class 2, transcription factor 1 (Octamer-binding transcription factor 1) (Oct-1) (OTF-1) (NF-A1).

Features of the cloned cDNA sequence

Description

Length: 2902 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	278 bp
Genome contig ID	gi89161185f_165468329
PolyA signal sequence (None)	+--------+--------+----*----+---- GCTTCATGGATTGGAGAACTTTCTAACCAAAAATT
Flanking genome sequence (183621 - 183670)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAAGAAACAAAAAAATCAAAAACAAACAAAAATA

Features of the protein sequence

Description

Length: 793 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
CAI15170	1.6e-192	100.0	POU class 2 hom...	Homo sapiens
BAG52361	2.6e-192	99.8	unnamed protein...	Homo sapiens
P14859	2.9e-187	100.0	POU domain, cla...	Homo sapiens
AAP36566	2.9e-187	100.0	POU domain, cla...	synthetic construct
CAI15167	2.9e-187	100.0	POU class 2 hom...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000327	340	399	PD000583	POU-specific
BlastProDom	IPR001356	429	485	PD000010	Homeobox
FPrintScan	IPR000972	231	246	PR00029	Octamer-binding transcription factor
	IPR000972	255	270	PR00029	Octamer-binding transcription factor
	IPR000972	279	291	PR00029	Octamer-binding transcription factor
	IPR000972	330	341	PR00029	Octamer-binding transcription factor
	IPR013847	349	366	PR00028	POU
	IPR013847	372	385	PR00028	POU
	IPR013847	388	403	PR00028	POU
	IPR013847	428	448	PR00028	POU
	IPR013847	463	478	PR00028	POU
HMMPfam	IPR000327	330	404	PF00157	POU-specific
HMMPfam	IPR001356	430	486	PF00046	Homeobox
HMMSmart	IPR000327	330	404	SM00352	POU-specific
HMMSmart	IPR001356	429	491	SM00389	Homeobox
ProfileScan	IPR000327	330	404	PS51179	POU-specific
ProfileScan	IPR001356	427	487	PS50071	Homeobox
ScanRegExp	IPR000327	348	360	PS00035	POU-specific
	IPR000327	372	385	PS00465	POU-specific
	IPR001356	462	485	PS00027	Homeobox

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp