Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK03173
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK03173
Clone name ek00356
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol DEK
cDNA sequence DNA sequence (2738 bp)
Predicted protein sequence (395 aa)
Flexi ORF Clone FXC03173
Description Protein DEK.
Features of the cloned cDNA sequence

Length: 2738 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 1548 bp
Genome contig ID gi89161210r_18232381
PolyA signal sequence
(AATAAA,-25)
+----*----+----*----+----*----+----
TGTCAATAAAAATAAATCTAAATCACTGGTGTTTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAGTCACTTGCATTTGATATCTTATAGGTGTATATAGCATTTCCTTATGG

Features of the protein sequence

Length: 395 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
P35659 1.9e-102 99.4 Protein DEK.
Homo sapiens
ABZ92195 4e-102 99.2 DEK oncogene (D...
synthetic construct
EAW55403 8.6e-102 99.1 DEK oncogene (D...
Homo sapiens
XP_001101463 3.4e-101 98.4 similar to DEK ...
Macaca mulatta
XP_001927944 1.9e-98 95.2 similar to DEK ...
Sus scrofa
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR003034 169 203 PF02037 DNA-binding SAP
IPR014876 341 395 PF08766 DEK C terminal
HMMSmart IPR003034 169 203 SM00513 DNA-binding SAP
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp