ORK03234

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK03234

Order Kazusa clone(s) from :

Accession No
Product ID	ORK03234
Clone name	fj17491
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	ZBTB6
cDNA sequence	DNA sequence (4085 bp) Predicted protein sequence (431 aa)
HaloTag ORF Clone	FHC03234
Flexi ORF Clone	FXC03234
Description	zinc finger and BTB domain containing 6

Features of the cloned cDNA sequence

Description

Length: 4085 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	2746 bp
Genome contig ID	gi89161216r_124610152
PolyA signal sequence (AATAAA,-27)	+--------+--------+----*----+---- TAAGAAATAATAAACTGGAGGTGGGAATGGAGAAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AATGTGTTTTGTCTTCATCTTTGAATTTTAAAGGATACAATTTAAAGGAT

Features of the protein sequence

Description

Length: 431 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q15916	8.9e-174	100.0	Zinc finger and...	Homo sapiens
XP_001085107	4.2e-172	99.0	zinc finger pro...	Macaca mulatta
XP_548464	1.3e-167	95.8	similar to Zinc...	Canis lupus fam...
XP_001502356	1.3e-166	95.9	similar to Zinc...	Equus caballus
Q0V8G8	6.9e-165	94.5	Zinc finger and...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013069	30	134	PF00651	BTB/POZ
	IPR007087	308	330	PF00096	Zinc finger
	IPR007087	333	355	PF00096	Zinc finger
	IPR007087	361	383	PF00096	Zinc finger
	IPR007087	389	412	PF00096	Zinc finger
HMMSmart	IPR000210	40	134	SM00225	BTB/POZ-like
	IPR015880	308	330	SM00355	Zinc finger
	IPR015880	333	355	SM00355	Zinc finger
	IPR015880	361	383	SM00355	Zinc finger
	IPR015880	389	412	SM00355	Zinc finger
ProfileScan	IPR000210	40	104	PS50097	BTB/POZ-like
	IPR007087	308	330	PS50157	Zinc finger
	IPR007087	333	360	PS50157	Zinc finger
	IPR007087	361	388	PS50157	Zinc finger
	IPR007087	389	412	PS50157	Zinc finger
ScanRegExp	IPR002048	161	173	PS00018	Calcium-binding EF-hand
	IPR007087	310	330	PS00028	Zinc finger
	IPR007087	335	355	PS00028	Zinc finger
	IPR007087	363	383	PS00028	Zinc finger
	IPR007087	391	412	PS00028	Zinc finger

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp