ORK03289

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK03289

Order Kazusa clone(s) from :

Accession No
Product ID	ORK03289
Clone name	hj07171
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	RXRA
cDNA sequence	DNA sequence (4946 bp) Predicted protein sequence (490 aa)
HaloTag ORF Clone	FHC03289
Flexi ORF Clone	FXC03289
Description	Retinoic acid receptor RXR-alpha (Retinoid X receptor alpha).

Features of the cloned cDNA sequence

Description

Length: 4946 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	3473 bp
Genome contig ID	gi89161216f_136258279
PolyA signal sequence (None)	+--------+--------+----*----+---- AGATAAGAGAAAATGTCTAAAGCATCTGGAAAGGT
Flanking genome sequence (213481 - 213530)	----+--------+--------+--------+--------+----* AAAAAAAAAAAATCTATTTTTGTACAAATGTAATTTTATCCCTCATGTAT

Features of the protein sequence

Description

Length: 490 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAH63827	3e-175	100.0	RXRA protein [H...	Homo sapiens
AAG02188	1e-164	99.7	retinoid-X-rece...	Cloning vector ...
AAC95154	1e-164	99.7	retinoic acid r...	Cloning vector ...
P19793	1.7e-164	100.0	Retinoic acid r...	Homo sapiens
BAE73032	1.5e-163	99.3	hypothetical pr...	Macaca fascicularis

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001628	162	229	PD000035	Zinc finger
FPrintScan	IPR001628	163	179	PR00047	Zinc finger
	IPR001628	179	194	PR00047	Zinc finger
	IPR001628	212	220	PR00047	Zinc finger
	IPR001628	220	228	PR00047	Zinc finger
	IPR001723	224	234	PR00398	Steroid hormone receptor
	IPR000003	229	243	PR00545	Retinoid X receptor
	IPR000003	256	275	PR00545	Retinoid X receptor
	IPR000003	290	310	PR00545	Retinoid X receptor
	IPR001723	299	320	PR00398	Steroid hormone receptor
	IPR001723	320	336	PR00398	Steroid hormone receptor
	IPR000003	334	351	PR00545	Retinoid X receptor
	IPR000003	374	394	PR00545	Retinoid X receptor
	IPR001723	388	403	PR00398	Steroid hormone receptor
	IPR000003	414	431	PR00545	Retinoid X receptor
	IPR000003	435	454	PR00545	Retinoid X receptor
	IPR001723	445	462	PR00398	Steroid hormone receptor
	IPR000003	462	481	PR00545	Retinoid X receptor
HMMPfam	IPR001628	161	236	PF00105	Zinc finger
HMMPfam	IPR000536	301	482	PF00104	Nuclear hormone receptor
HMMSmart	IPR001628	160	231	SM00399	Zinc finger
HMMSmart	IPR000536	298	457	SM00430	Nuclear hormone receptor
ProfileScan	IPR001628	160	235	PS51030	Zinc finger
ScanRegExp	IPR001628	163	189	PS00031	Zinc finger

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp