ORK03290

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK03290

Order Kazusa clone(s) from :

Accession No
Product ID	ORK03290
Clone name	ee13770
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	CUX1
cDNA sequence	DNA sequence (2902 bp) Predicted protein sequence (677 aa)
HaloTag ORF Clone	FHC03290
Flexi ORF Clone	FXC03290
Description	Protein CASP.

Features of the cloned cDNA sequence

Description

Length: 2902 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	867 bp
Genome contig ID	gi89161213f_101146033
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- GCTTTGCACATTTGAAATAAACCACGGTTGCAGCC
Flanking genome sequence (567938 - 567987)	----+--------+--------+--------+--------+----* ACCCTGGTGCCCTGTGCTCTGGGACGCTGGAGGGACTGGAGGCTGGTGGG

Features of the protein sequence

Description

Length: 677 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q13948	3.1e-194	100.0	Protein CASP.	Homo sapiens
BAD96552	6e-194	99.7	CCAAT displacem...	Homo sapiens
AAA35654	6.7e-194	99.8	alternatively s...	Homo sapiens
Q5R8V1	7.5e-194	99.5	Protein CASP.	Pongo abelii
NP_852477	6e-193	99.7	protein CASP is...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR012955	420	646	PF08172	CASP

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	618	TIGFFYTLFLHCLVFLVLYKLAW	640	PRIMARY	23