ORK03293

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK03293

Order Kazusa clone(s) from :

Accession No
Product ID	ORK03293
Clone name	ej01088
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	ITGB1
cDNA sequence	DNA sequence (3853 bp) Predicted protein sequence (893 aa)
HaloTag ORF Clone	FHC03293
Flexi ORF Clone	FXC03293
Description	Integrin beta-1 precursor (Fibronectin receptor subunit beta) (Integrin VLA-4 subunit beta) (CD29 antigen).

Features of the cloned cDNA sequence

Description

Length: 3853 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1170 bp
Genome contig ID	gi89161187r_33129334
PolyA signal sequence (ATTAAA,-22)	+--------+--------+----*----+---- ACTGAAGTTATTTATTAAATATGCCTAAAATACTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAATCGGATGTCTTGACTCTGATGTATTTTATCAGGTTGTGTGCATGAAA

Features of the protein sequence

Description

Length: 893 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
CAD97649	100.0	hypothetical pr...	Homo sapiens
XP_507735	91.2	hypothetical pr...	Pan troglodytes
AAH20057	100.0	Integrin, beta ...	Homo sapiens
BAF84386	99.8	unnamed protein...	Homo sapiens
P05556	99.7	Integrin beta-1...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR015812	127	143	PR01186	Integrin beta subunit
	IPR015812	159	178	PR01186	Integrin beta subunit
	IPR015812	208	221	PR01186	Integrin beta subunit
	IPR015812	236	254	PR01186	Integrin beta subunit
	IPR015812	276	295	PR01186	Integrin beta subunit
	IPR015812	308	327	PR01186	Integrin beta subunit
	IPR015812	341	363	PR01186	Integrin beta subunit
	IPR015812	367	382	PR01186	Integrin beta subunit
	IPR015812	410	433	PR01186	Integrin beta subunit
	IPR015812	446	470	PR01186	Integrin beta subunit
	IPR015812	620	633	PR01186	Integrin beta subunit
	IPR015812	822	839	PR01186	Integrin beta subunit
	IPR015812	839	857	PR01186	Integrin beta subunit
	IPR015812	874	884	PR01186	Integrin beta subunit
HMMPfam	IPR002369	129	559	PF00362	Integrin beta subunit
	IPR013111	611	648	PF07974	EGF
	IPR013111	655	685	PF07974	EGF
	IPR013111	694	725	PF07974	EGF
	IPR012896	735	823	PF07965	Integrin beta subunit
	IPR014836	847	892	PF08725	Integrin beta subunit
HMMSmart	IPR003659	121	171	SM00423	Plexin/semaphorin/integrin
HMMSmart	IPR002369	129	559	SM00187	Integrin beta subunit
ScanRegExp	IPR013032	584	595	PS00022	EGF-like region
	IPR015812	620	633	PS00243	Integrin beta subunit
	IPR015812	663	676	PS00243	Integrin beta subunit
	IPR013032	674	685	PS00022	EGF-like region
	IPR015812	702	715	PS00243	Integrin beta subunit

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	826	PIVAGVVAGIVLIGLALLLIWKL	848	PRIMARY	23