Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK03297
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK03297
Clone name fk13658
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol MXD4
cDNA sequence DNA sequence (3777 bp)
Predicted protein sequence (220 aa)
Flexi ORF Clone FXC03297
Description Max-interacting transcriptional repressor MAD4 (Max-associated protein 4) (MAX dimerization protein 4).
Features of the cloned cDNA sequence

Length: 3777 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 3112 bp
Genome contig ID gi89161207r_2118956
PolyA signal sequence
(TATAAA,-26)
+----*----+----*----+----*----+----
TCATTGTAATATAAATACAGATTTTTATATCTCAC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
CCTGCTGGCTCCGGCTCTTTCTGTGGTTGTCACTGTCAGCGTGCTTCGCG

Features of the protein sequence

Length: 220 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
EAW82534 7.3e-83 100.0 MAX dimerizatio...
Homo sapiens
XP_001118504 9.7e-80 96.0 similar to MAD4...
Macaca mulatta
Q14582 4.4e-78 100.0 Max dimerizatio...
Homo sapiens
AAV38770 4.4e-78 100.0 MAX dimerizatio...
synthetic construct
EDM00104 2.5e-72 90.9 Max dimerizatio...
Rattus norvegicus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR001092 65 117 PF00010 Basic helix-loop-helix dimerisation region bHLH
HMMSmart IPR001092 70 122 SM00353 Basic helix-loop-helix dimerisation region bHLH
ProfileScan IPR001092 63 117 PS50888 Basic helix-loop-helix dimerisation region bHLH
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp