ORK03382

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK03382

Order Kazusa clone(s) from :

Accession No
Product ID	ORK03382
Clone name	fk04789
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	SMAD2
cDNA sequence	DNA sequence (3076 bp) Predicted protein sequence (501 aa)
HaloTag ORF Clone	FHC03382
Flexi ORF Clone	FXC03382
Description	Mothers against decapentaplegic homolog 2 (SMAD 2) (Mothers against DPP homolog 2) (Mad-related protein 2) (hMAD-2) (JV18-1) (hSMAD2).

Features of the cloned cDNA sequence

Description

Length: 3076 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1570 bp
Genome contig ID	gi51511735r_43520626
PolyA signal sequence (CATAAA,-20)	+--------+--------+----*----+---- TCCTGGTCGTCTTTTCATAAATTTTCATATTTTTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAGCTGTCTTTGGTACTTGTTCTTTGAAATCATATCCACCTGTCTCTATA

Features of the protein sequence

Description

Length: 501 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q15796	1.3e-194	100.0	Mothers against...	Homo sapiens
AAP88883	1.3e-194	100.0	MAD, mothers ag...	synthetic construct
Q5R7C0	2.7e-194	99.7	Mothers against...	Pongo abelii
Q1W668	4.8e-194	99.7	Mothers against...	Bos taurus
XP_001365064	6.4e-194	99.5	similar to SMAD...	Monodelphis dom...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003619	72	205	PF03165	MAD homology 1
HMMPfam	IPR001132	302	479	PF03166	MAD homology 2
HMMSmart	IPR003619	70	208	SM00523	MAD homology 1
HMMSmart	IPR001132	306	477	SM00524	MAD homology 2
ProfileScan	IPR013019	44	210	PS51075	MAD homology
ProfileScan	IPR001132	308	501	PS51076	MAD homology 2

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp